báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

... of care in studying and improving medication safety, and our study contributes to that agenda by adopting a collaborative approach to exploring the nature and safety of medication management for ... collaborators from the project's inception, including provincial health minis- tries, national health information, patient safety, and accreditation bodies, and provincial and fed...

Ngày tải lên: 10/08/2014, 10:23

... M: Review and Recommendations for the Development of Participatory Research in Health Promotion in Canada Ottawa: The Royal Society of Canada; 1995. 2. Macaulay AC, Commanda LE, Freeman WL, Gibson ... itera- tive and overlapping steps: 1. Searching for explanatory middle-range theories. 2. Preliminary annotating and extracting of data that pertain to PR processes. 3. Identifying dem...

Ngày tải lên: 10/08/2014, 10:23

... protein to which glycosaminoglycan (GAG) side chains are covalently attached. GAGs are linear polysaccharides consisting of a repeating disaccharide, generally of an acetylated amino sugar alternating ... splice variant of heparanase. T5, a functional human heparanase splice variant Almost all protein-coding genes contain introns that are removed in the nucleus by RNA splicing and are o...

Ngày tải lên: 15/03/2014, 23:20

... 353 AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354 ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409L GGAGTGTCCTTCTATAACATA TTTGGAGTGTCACTTAATACACC Y346F GTCACTATCATCTCCCAT GCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAAT GCACCCTTTGATGTTTG T35 2A 37...

Ngày tải lên: 30/03/2014, 15:20

... Glickman, 2006 Prevalence study To examine demographic and clinical characteristics of deaf and hearing psychiatric in- patients A total of 64 deaf adult patients of specialist deaf unit at Westborough ... Health and non-governmental organisations [3,5] also reveal increased difficulties for deaf people in accessing mental health and social care services. These factors may put deaf...

Ngày tải lên: 08/08/2014, 23:20

... ML, Kader AS, Beckham WA, Olivotto IA: Target volume delineation for partial breast radiotherapy planning: clinical characteristics associated with low interobserver concordance. Int J Radiat ... collected before and after a theoretical course. Delineation was improved after education. Our study also demonstrates that incorporating a practical delineation workshop during training imp...

Ngày tải lên: 09/08/2014, 09:21

... Sabry Address: Prince Salman Center for Kidney Diseases, Riyadh, Kingdom of Saudi Arabia Email: Khalid A Al-Saran* - khalid_aln@yahoo.co.uk; Alaa A Sabry - asabry20@yahoo.com * Corresponding author ... Central Page 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Pregnancy in dialysis patients: a case series Khalid A Al-Saran...

Ngày tải lên: 11/08/2014, 10:23

... concha bullosa polyp in a 45-year-old man. The clinical presentation, radiological and endoscopic findings, and management approach for this case are discussed. Case presentation A 45-year-old man ... clinic with com- plaints of nasal obstruction and headache. He had had these problems for 4 years. There was no history of nasal trauma or nasal allergy. Nasal examination revealed rig...

Ngày tải lên: 11/08/2014, 23:22

... may be offset by complications of catheter use, such as pulmonary Commentary Variation in sepsis care: a wake-up call Mary E Hartman 1 and Derek C Angus 2 1 Research Fellow, CRISMA (Clinical Research, ... prophylaxis in critically ill patients. Resolving discordant meta-analyses. JAMA 1996, 275:308-314. 25. Australian and New Zealand Intensive Care Society (ANZICS) Clinical Trials...

Ngày tải lên: 12/08/2014, 19:22

Ngày tải lên: 13/08/2014, 03:20