0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

báo cáo khoa học:

báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

... of care in studying and improving medication safety,and our study contributes to that agenda by adopting a collaborative approach to exploring the nature and safetyof medication management for ... collaborators fromthe project's inception, including provincial health minis-tries, national health information, patient safety, andaccreditation bodies, and provincial and federal fundingpartners ... ON: Canadian Pharmacists Association; 2007:319-335. 26. Lang A, Edwards N, Fleiszer A: Safety in home care: A broadened perspective on patient safety. International Journal of Quality in Health...
  • 9
  • 306
  • 0
báo cáo khoa học:

báo cáo khoa học: "Assessing the outcomes of participatory research: protocol for identifying, selecting, appraising and synthesizing the literature for realist review" pps

... M: Review and Recommendations for the Development of Participatory Research in Health Promotion in Canada Ottawa: The Royal Society ofCanada; 1995.2. Macaulay AC, Commanda LE, Freeman WL, Gibson ... itera-tive and overlapping steps:1. Searching for explanatory middle-range theories.2. Preliminary annotating and extracting of data thatpertain to PR processes.3. Identifying demi-regularities based ... Schultz A, Parker EA, Becker AB, Allen AJ III, Guzman JR: CriticalIssues in Developing and Following Community Based Participatory Research Principles. In Community-Based Participatory Research for...
  • 8
  • 286
  • 0
Báo cáo khoa học: Proteoglycans in health and disease: new concepts for heparanase function in tumor progression and metastasis pptx

Báo cáo khoa học: Proteoglycans in health and disease: new concepts for heparanase function in tumor progression and metastasis pptx

... protein to whichglycosaminoglycan (GAG) side chains are covalentlyattached. GAGs are linear polysaccharides consistingof a repeating disaccharide, generally of an acetylatedamino sugar alternating ... splicevariant of heparanase.T5, a functional human heparanase splice variantAlmost all protein-coding genes contain introns thatare removed in the nucleus by RNA splicing and areoften alternatively ... malignancyand their pharmacological targeting. FEBS J 277,3904–3923.93 Purushothaman A, Uyama T, Kobayashi F, YamadaS, Sugahara K, Rapraeger AC & Sanderson RD (2010)Heparanase-enhanced...
  • 14
  • 397
  • 0
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

... 353AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTGCTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGAAGAATTCAAAGTCTGAAATTCGGGTTTGTATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409LGGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC Y346FGTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAATGCACCCTTTGATGTTTG T35 2A 3754 A. Noiriel ... below and that w ith the complementary sequence.NumberGene cloningATATATGGATCCATGTCTCTATTACTGG AAGAGATC 337TATATAGGTACCTTATGCATCAACAGAGACACTTAC 338ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC...
  • 13
  • 448
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx

... Glickman, 2006 Prevalence study To examine demographic and clinical characteristics of deaf and hearing psychiatric in- patients A total of 64 deaf adult patients of specialist deaf unit at Westborough ... Health and non-governmental organisations [3,5] alsoreveal increased difficulties for deaf people in accessingmental health and social care services. These factors mayput deaf individuals at ... UK and this did notresult in any additional material. Furthermore, we madecontact with key researchers in the field and searched dis-sertation and 'grey' literature databases. A formal...
  • 9
  • 359
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

... ML, Kader AS, Beckham WA, Olivotto IA: Target volume delineation for partial breast radiotherapy planning: clinical characteristics associated with low interobserver concordance. Int J Radiat ... collected before and after a theoretical course. Delineation was improved after education. Our study also demonstrates that incorporating a practical delineation workshop during training improves ... respiratory gating. Lung Cancer 2006,51:41-51. 15. Kepka L, Bujko K, Garmol D, Palucki J, Zolciak-Siwinska A, Guzel-Szczepiorkowska Z, Pietrzak L, Komosinska K, Sprawka A, Garbaczewska A: Delineation...
  • 24
  • 376
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Pregnancy in dialysis patients: a case series" ppt

... SabryAddress: Prince Salman Center for Kidney Diseases, Riyadh, Kingdom of Saudi ArabiaEmail: Khalid A Al-Saran* - khalid_aln@yahoo.co.uk; Alaa A Sabry - asabry20@yahoo.com* Corresponding author ... CentralPage 1 of 4(page number not for citation purposes)Journal of Medical Case ReportsOpen AccessCase reportPregnancy in dialysis patients: a case seriesKhalid A Al-Saran* and Alaa A SabryAddress: ... complications and a considerable risk of renal disease progression. Due to substantial improvements in antenatal andneonatal care, fetal outcome has improved considerably in the last two decade. A Saudi...
  • 4
  • 455
  • 0
báo cáo khoa học:

báo cáo khoa học:" Polyp in concha bullosa: a case report and review of the literature" pot

... concha bullosapolyp in a 45-year-old man. The clinical presentation,radiological and endoscopic findings, and managementapproach for this case are discussed.Case presentation A 45-year-old man ... clinic with com-plaints of nasal obstruction and headache. He had hadthese problems for 4 years. There was no history of nasaltrauma or nasal allergy. Nasal examination revealed rightseptal ... content details. Allauthors read and approved the final manuscript.References1. Yanagisawa E: Concha bullosa polyp. In Atlas of Rhinoscopy: Endo-scopic Sinonasal Anatomy and Pathology Ch...
  • 3
  • 385
  • 0
Báo cáo y học:

Báo cáo y học: "Variation in sepsis care: a wake-up call" ppsx

... may beoffset by complications of catheter use, such as pulmonaryCommentaryVariation in sepsis care: a wake-up callMary E Hartman1and Derek C Angus21 Research Fellow, CRISMA (Clinical Research, ... prophylaxis in critically illpatients. Resolving discordant meta-analyses. JAMA 1996,275:308-314.25. Australian and New Zealand Intensive Care Society (ANZICS)Clinical Trials Group: Low-dose dopamine ... 348:5-14.12. Kac G, Durain E, Amrein C, Herisson E, Fiemeyer A, Buu-Hoi A: Colonization and infection of pulmonary artery catheter in cardiac surgery patients: epidemiology and multivariateanalysis...
  • 3
  • 416
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM