báo cáo khoa học: " A realistic evaluation: the case of protocol-based care" docx

... is a generative conception of causality i.e., not an explanation of the variables that are related to one another, rather how they are associated. 5. Researchers should aim for cumulation rather ... setting/con- text, for example, a cardiac surgical unit (CSU), and the 'embedded unit' of that case the use of a particular stan- dardised care approach, for exampl...

Ngày tải lên: 10/08/2014, 10:22

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAG...

Ngày tải lên: 23/03/2014, 13:20

... a program to translate Swahili into English is to be useful (rather than purely academic research), it must be usable in Tanzania. Until recently, the only computers available in Tanzania ... indicative of the need to insert an article, and of which article to insert. 2. Structure of the Translation Scheme Three dictionaries are envisaged: a stem dictionary, a prefix...

Ngày tải lên: 23/03/2014, 13:20

... notable (notable deterioration) fausse manoeuvre (wrong operation) action de l'op~rateur (action of the operator) capacit~ interne (internal capacity) capacit~ totale (total capacity) ... the automatic extraction takes one hour and the validation of the links has been done in two hours. The main difficulty is to evaluate the recall in the results because there is...

Ngày tải lên: 23/03/2014, 19:20

... the trailing term leads to the approximation in Antoniak (1974). However, we can obtain an exact formula for the expecta- tion by utilising the relationship between the Digamma function and the ... tracking. 6 Instead we main- tain a histogram for each dish w i of the frequency of a table having a particular number of customers. Figure 3 depicts the histogram and e...

Ngày tải lên: 31/03/2014, 00:20

... ':TA:PaulPaul' and ':TA: Maria Maria' are 'lexical transfer rules'; they state a transfer relation between atomic FSs (i.e. words, in the context of MT), rather than ... depending on the content of the particular rule set in use. Transfer rules associate the analysis of one FS with the synthesis of another; they may be thought of as...

Ngày tải lên: 01/04/2014, 00:20

... Yamakawa H, Oyama S, Mitsuhashi H, Sasagawa N, Uchino S, Kohsaka S, Ishiura S: Neuroligins 3 and 4X interact with syntrophin-gamma2, and the interactions are a ected by autism-related mutations. ... Vargha-Khadem F, Monaco AP: The SPCH1 region on human 7q31: genomic characterization of the critical interval and localization of translocations associated with speech and language...

Ngày tải lên: 11/08/2014, 12:20

... with respect to financials, corporate strategy and health impact. We then analyze the Shantha case as a whole as an illustration of the globalization of healthcare R&D, to draw out key lessons ... [60]. Shantha’s affordable high-quality vaccines have already reached hundreds of millions of childre n globally. The open question that Shantha and Varaprasa d have always str...

Ngày tải lên: 11/08/2014, 14:21

... mortality. Of all the potential factors examined, the only other organizational characteristic associated with the outcome of patients with sepsis was the presence of a medium care unit, a finding that may ... experience, then perhaps the best solution is to regionalize critical care in a manner similar to that for trauma or neonatal care [10]. Regionalization offers th...

Ngày tải lên: 13/08/2014, 03:20

... automatically extracts the relevant data for these tests from text corpora and corpora-based databases, and use this system to measure the applicability and accuracy of each method. We apply statistical ... Using automatically collected data, the accuracy and applicability of each method is quantified, and a statistical analysis of the significance of the results is p...

Ngày tải lên: 31/03/2014, 06:20