báo cáo khoa học: " Translating research into practice in Leeds and Bradford (TRiPLaB): a protocol for a programme of research" ppsx

... key topics in the relevant clinical area. For example, in NHS Bradford and Airedale, stakeholder consultation in the area of child and maternal health care with a range of commissioners and practitioners ... distribution, and reproduction in any medium, provided the original work is properly cited. Study protocol Translating research into practice in Lee...

Ngày tải lên: 10/08/2014, 10:22

... suitable for the development of large and complex gram- mars by using a declarative format for specifying grammar rules. In our formalism, translation types are associated with the phrasal categories ... rules that define a language and associate structural descriptions (parse trees) for each sentence in that language in the usual way. Nodes in the parse tree are as...

Ngày tải lên: 31/03/2014, 17:20

... ¢-GCAA TGGACTTCGGCAACCTCTCTAGCTTC-3¢;CKX14, 5¢-GATTGTCATCAGAATGGAATCCCTTCGGAG-3¢; and one antisense: CKX13, 5¢-GCACCCTATC CAAGA ACTCAATGTAAGTGA-3¢) were designed to amplify fragments of HvCKX2 and HvCKX3 genes a ccording ... program. Construction of recombinant DNA for transformation and expression A1 0lL aliquot of a heat-treated (7 min, 100 °C) commer- cial barley genomic...

Ngày tải lên: 19/02/2014, 16:20

... feature space into two parts. In semi-supervised sentiment classification, the data are randomly partitioned into labeled training data, unlabeled data, and testing data with the proportion of ... classification as a standard classification problem in which labeled data in a domain are used to train a domain-specific classifier. Pang et al. (2002) are the first to ap...

Ngày tải lên: 07/03/2014, 22:20

... providing the SC-514 inhibitor. We thank also Paul Hayter, Sasha Sreckovic and Matthew Strawbridge with help in growing and analyzing the A5 49 cells and finally BBSRC for the award of a CASE studentship ... of analysis (in vitro, cell-based and in silico analysis) will facilitate systematic understanding of the underlying properties of this signaling pathway. To summ...

Ngày tải lên: 16/03/2014, 11:20

... TTCGACTTGTTCGTGGA Sequencing M13 forward GTAAAACGACGGCCAG M13 reverse CAGGAAACAGCTATGAC Site-directed Lep d 2.01 forward A5 5T CCATCAAGGTTTTGACCAAGGTTGCCGGTACC mutagenesis Lep d 2.01 reverse A5 5T ... sequentially incubated with rabbit anti-human IgE (MIAB, Uppsala, Sweden) for 2 h and alkaline phosphatase conjugated goat anti-rabbit IgG (DAKO, Glostrup, Denmark) for 1 h. Finally, a...

Ngày tải lên: 17/03/2014, 09:20

... Minimum Error Rate Training in Statis- tical Machine Translation. In ACL, Sapporo, Japan. K. Papineni, S. Roukos, T. Ward, and W. Zhu. 2001. Bleu: a Method for Automatic Evaluation of Ma- chine ... Dynamic Programming in Semiring and Hypergraph Frameworks. In COL- ING, Manchester, UK. S. Kumar and W. Byrne. 2004. Minimum Bayes- Risk Decoding for Statistical Machine Trans...

Ngày tải lên: 23/03/2014, 16:21

... 76:138-45. 20. Kodaira T, Tomita N, Tachibana H, Nakamura T, Nakahara R, Inokuchi H, Fuwa N: Aichi cancer center initial experience of intensity modulated radiation therapy for nasopharyngeal cancer using ... advanced nasopharyngeal carcinoma: an individual patient data meta-analysis of eight randomized trials and 1753 patients. Int J Radiat Oncol Biol Phys 2006, 64:47-56. 2. Langendi...

Ngày tải lên: 09/08/2014, 09:21

... Giannarelli of the Department of Oncology Regina Elena National Cancer Institute for statistical analysis. Author details 1 Department of Hematology Regina Elena National Cancer Institute, Via Elio Chianesi, ... follicular lymphoma: a report of 9 cases Francesco Pisani 1* , Carlo Ludovico Maini 2 , Rosa Sciuto 2 , Laura Dessanti 1 , Mariella D’Andrea 1 , Daniela Assisi 3 , Maria C...

Ngày tải lên: 10/08/2014, 10:21

... new insights into the presence of particular species and strains in the human gut and their variance between intestinal locations and species of mammal. For example, 16S RNA approaches have ... production and conversion; carbohydrate transport and metabolism; amino acid transport and metabolism; coenzyme transport and metabolism; secondary metabolites biosynthesis,...

Ngày tải lên: 11/08/2014, 12:21