báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot

... 1 Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu 1 * § , Jintao Zhuang 1 *, Wenwei Wang 1 , Liang Zhao 1 , Liangyun Zhao 1 , ... article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Screening and Identification of a...

Ngày tải lên: 10/08/2014, 10:21

... CCTGTCAACTGAGCAGCACTTTG eae A- F GTGGCGAATACTGGCGAGACT 890 bp Fagan et al [14] eae A- R CCCCATTCTTTTTCACCGTCG hly A- F ACGATGTGGTTTATTCTGGA 165 bp Fagan et al [14] hly A- R CTTCACGTGACCATACATAT H7-F ... P010726-25, and O157-C-1-2), and 14 USA isolates; 4 strains of ATCC (A1 , A2 , A3 , and A4 ), 6 strains of Cornell University (C1, C2, C3, C4, C5, and C6), and 4 strai...

Ngày tải lên: 07/08/2014, 18:21

... The pandas in this case study did not respond to anti-bacterial or anti-fungal therapy. However, the clinical Isolation and identification of a canine coronavirus strain from giant pandas 263 Fig. ... recommendations and then sequenced. The sequence was analyzed by GENETYX version 9.0 computer software (Software Development, Japan) and DNAMAN version 4.0 (Lynnon BioSoft, C...

Ngày tải lên: 07/08/2014, 23:22

... enzymes participate in numerous biosynthetic pathways and catalyse a broad range of reactions mainly involving the cleavage and the formation of C–C-bonds. For instance, they catalyse nonoxidative and ... Benzaldehyde lyase (BAL) catalyzes cleavage and formation of R-benzoin. BAL is known to accept several other substituted aro- matic or aliphatic acyl-acceptors as substrates...

Ngày tải lên: 07/03/2014, 12:20

... 7, p 3 A3 ¢p5 A2 ¢p5 A; 8, p 3 A3 ¢p5 A3 ¢p5 A; 9, adenosine; 10, mixture of A2 ¢p5 A and A2 ¢p5 A2 ¢p5 A2 ¢p5 A; 11, mixture of A2 ¢p5 A2 ¢p5 A and A3 ¢p5 A2 ¢- p5 A( m ⁄ z 924.6); 12, A2 ¢p5 A3 ¢p5 A( m ⁄ z ... PAGE (A) and western blot analysis (B) of the affinity purified C-terminally and N-terminally His-tagged recombinant 2- 5A synthetase from G. cydonium (lanes...

Ngày tải lên: 23/03/2014, 09:20

... at any development stage of the stand, the programmed computer (that be- comes a simulation system) can store the state of all tree crowns by means of a stand map, and ... This area increases linearly from the base of the stem annual shoot; then it stays equal to the value reached at the base of the live crown, and increases again...

Ngày tải lên: 08/08/2014, 23:22

... radiata esti- mated from transmittance of the sun’s beam. Agric For Meteorol 55 Lang ARG (1991) Application of some of Cauchy’s theorems to estimation of surface areas of ... reflectance and the transmittance of the foliage elements (ρ and τ) as well as on the PAR reflectance of the understorey. Reflectance (p) and trans...

Ngày tải lên: 09/08/2014, 04:20

... Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser 1 , Martin Koskas 1 , Francine Walker 2 , Dominique Luton 1 and Chadi Yazbeck 1,3* ... it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Diagnosis and management of an immature teratoma during ovarian...

Ngày tải lên: 10/08/2014, 22:20

... TGT ATG GAT CCT GAG CCC ATA 3') and reverse primers (5' ACC TGC CTA TCA CTC GAG AAA TAA TGG TAA CCA TAT TTG GTT 3') incorpo- rated EcoRI and XhoI sites at the 5' and 3'ends ... Yong Kang (University of Western Ontario), using a forward (5' GTC GAC CCT ATA GTG CAG AAC 3') and reverse primers (5' AAG CTT TCT AGA TTA TTA CAA AAC TCT TGC TTT ATG...

Ngày tải lên: 12/08/2014, 04:21

... carcinoma. Preliminary studies have shown an anti-tumor activity of sorafenib in a variety of tumor types such as renal cell carcinoma, melanoma, thyroid cancer, ovarian cancer, sarcoma, and pancreatic ... All authors participated in drafting and editing the manuscript. All authors read and approved the final manuscript. Authors' information The authors provide specialize...

Ngày tải lên: 10/08/2014, 22:20