báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx

... et al.: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic ... tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgt...

Ngày tải lên: 10/08/2014, 10:21

... in vitro data suggest that the proline-rich fragments of C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2. [We have also found an in vivo association ... Caskin1 fragments As described in the introductory paragraphs, the N-terminal half of Caskin1 contains a number of well-known domains involved in protein–protein inter- ac...

Ngày tải lên: 16/03/2014, 02:20

... recycling. Haptoglobin is increased in patients with acute inflammatory disease as one of positive acute phase proteins (APPs) and it is involved Plasma diagnostic indicators of deoxynivalenol intoxication ... identification of potential biomarkers against a variety of diseases, including tumors and diabetes, and the protein chip platform has been Plasma diagnosti...

Ngày tải lên: 07/08/2014, 20:23

... such as IL-1 and TNF -a [2]. The pro-inflammation cytokines IL-1 and TNF -a are present in high levels in blood and serum during inflam- mation, and anti-inflammation cytokines are at low levels. This ... contributions AM participated in the design of the study and clinical evaluations. MK participated in the design of the study and clinical evaluations, and car...

Ngày tải lên: 09/08/2014, 08:22

... Care, University of Queensland, Brisbane, Australia, 5 Department of Hematology, Princess Alexandra Hospital, Brisbane, Australia and 6 Department of Chemical Pathology, Princess Alexandra ... 3168, Australia, 2 Intensive Care, Princess Alexandra Hospital Princess Alexandra Hospital, Brisbane, Australia, 3 Intensive Care, Wesley Hospital, Brisbane, Australia, 4 Department of...

Ngày tải lên: 10/08/2014, 22:20

... populations are provided in Additional file 3. Genetic variation within and between populations PCoA of candidat e gene haplotypes rev ealed large genetic variation within each population and ... rye. Additional material Additional file 1: Primer information and details on PCR amplification of eleven candidate genes. Additional file 2: Genetic diversities of eleven candidate...

Ngày tải lên: 11/08/2014, 11:21

... variability in the synthesis of pineal melatonin (Zarazaga et al. 199 8a and Zarazaga et al. 1998b). In contrast to an earlier study (An- dersson et al. 2000), there was no significant ef- fect of ... centrifuged and stored at - 20°C until analysed for melatonin content. Melatonin assay Plasma melatonin was analysed by radio im- munoassay (Bhhlmann Laboratories AG, Schö- nenbuch...

Ngày tải lên: 12/08/2014, 15:20

... mating, and intrauterine and conventional insemination Mattias Norrby* 1 , Mads T Madsen 2 , Charlotte Borg Alexandersen 3 , Hans Kindahl 4 and Andrzej Madej 1 Address: 1 Department of Anatomy, ... Central Page 1 of 7 (page number not for citation purposes) Acta Veterinaria Scandinavica Open Access Research Plasma concentrations of cortisol and PGF 2α metabolite in Dani...

Ngày tải lên: 12/08/2014, 18:22

... cortisol levels, both in CSF and serum, in the initial phase of bacterial menin- gitis, and to assess their correlation with inflammatory cytokines as well as routinely examined laboratory parameters. Also, ... The area under the curve was also evaluated. Table 1 Demographic and clinical data of 47 patients with bacterial meningitis Parameter Bacterial meningitis patients (n =...

Ngày tải lên: 13/08/2014, 03:20

... ⁄ protein interface as xenobiotic target site Kinetic analysis of tadpole narcosis Joachim Altschuh 1 , Sebastian Walcher 2 and Heinrich Sandermann, Jr 3,4 1 Institute of Biomathematics and Biometry, ... 1249–1254. 26 Mantipragada SB, Horva ´ th LI, Arias HR, Schwarz- mann G, Sandhoff K, Barrantes FJ & Marsh D (2003) Lipid–protein interactions and effect of local anesthet- ics...

Ngày tải lên: 19/02/2014, 18:20