báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... regimen followed by 90 yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases. Journal of Experimental & Clinical Cancer Research ... follicular lymphoma: a report of 9 cases Francesco Pisani 1* , Carlo Ludovico Maini 2 , Rosa Sciuto 2 , Laura Dessanti...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... sensitivity determinant of CPT1B J. Relat et al. 21 4 FEBS Journal 27 6 (20 09) 21 0 – 21 8 ª 20 08 The Authors Journal compilation ª 20 08 FEBS CPT1 assay CPT1 activity was assayed by the forward exchange method using ... performed at 1 mm carnitine as standard. To analyze PigE17DCPT1B and HumanD17ECPT1B mutants, the assay was performed at carnitine concentrations equal to...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx
... with Special Attention to Radiation Necrosis. Neurosurgery 20 04, 54 :11 11- 111 9. 19 . Terakawa Y, Tsuyuguchi N, Iwai Y, Yamanaka K, Higashiyama S, Takami T, Ohata K: Diagnostic accuracy of 11 C-methionine ... Recommandations Committee: Canadian recommendations for treatment of glioblastoma multiforme. Current Oncol 20 07, 14 :11 0 -11 7. doi :10 .11 86 /17 48- 717 X-5 -9 Ci...
Ngày tải lên: 09/08/2014, 10:20
báo cáo khoa học: "Use of RE-AIM to develop a multi-media facilitation tool for the patient-centered medical home" potx
... 20 02 February ;25 (2) : 3 19 -23 . (11 ) Srinivasan M, Przybylski M, Swigonski N. The Oregon Health Plan: predictors of office-based diabetic quality of care. Diabetes Care 20 01 February ;24 (2) :26 2-7. ... primary care setting. Diabetes Care 20 01; 24 (1) :22 -6. (13 ) Chin MH, Zhang JX, Merrell K. Diabetes in the African-American Medicare population. Diabetes Care 19...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo khoa hoc:" False rumours of disease outbreaks caused by infectious myonecrosis virus (IMNV) in the whiteleg shrimp in Asia" pdf
... 0 22 / 12 / 09 10 10 0 0 22 / 01/ 10 2 2 0 0 16 /03 /10 3 3 0 0 Malaysia 22 /08/06 5 5 0 0 Taiwan 10 / 09/ 07 3 3 0 0 Vietnam 07 /11 /06 2 2 0 0 25 / 01/ 10 3 3 0 0 21 / 06 /11 4 4 0 0 India 20 / 02/ 09 3 3 0 0 17 /03 /10 2 2 ... 0 04 /10 /06 15 0 15 0 28 /11 /06 2 2 0 0 04/05/07 10 4 6 0 08/06/07 8 4 4 0 10 /06/ 09 20 20 0 0 26 /06/ 09 5 0 5 0 09/ 07/ 09 3 2...
Ngày tải lên: 11/08/2014, 07:21
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... 0 .17 9. 21 ± 0.07 10 . 39 ± 0.08 11 .08 ± 0 .10 9. 96 ± 0. 21 8.08 ± 0 .23 Spleen 7.45 ± 0.06 8. 71 ± 0 .10 9 .17 ± 0.07 10 .20 ± 0 . 12 11 .16 ± 0 .14 11 .99 ± 0.07 10 .14 ± 0 .23 8 .97 ± 0 . 19 Lung 0 5 .90 ± 0 . 19 ... ACTGTGTTTCCCATCCATTGG 3 12 2- 314 3 GPV-FP 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA 3 098 - 3 12 0 VP3 -1 AAGCTTTGAAATGGCAGAGGGAGGA 3008-3033 16 58 VP3 -2 G...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "A 12 Week, Open Label, Phase I/IIa Study Using Apatone® for the Treatment of Prostate Cancer Patients Who Have Failed Standard Therapy" pps
... 5 .23 > 60 Increased 13 3 52 16 3 Decreased 2. 79 8 .90 Increased 14 21 . 1 81. 7 Increased 7 .24 4.30 Decreased 15 54 .2 11 2 Increased 2. 91 2. 88 Decreased 16 22 .0 30 .9 Increased 6.54 6.58 Increased ... Decreased 3.00 6.30 Increased 4 14 .6 9 .14 Decreased 27 .6 57.05 Increased 5 4.38 3.65 Decreased 2. 76 9 .17 Increased 6 19 .3 - 8 .11 Decreased 12 .1 -...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... J Dairy Sci 20 06, 89 :18 42 -18 53. 9. Onwuegbuzie AJ, Leech N: A call for qualitative power analysis. Qual & Quan 20 07, 41: 105 - 12 1. 10 . Aagaard-Hansen J: The challenges of cross-disciplinary research. ... Major advances in disease prevention in dairy cattle. J Dairy Sci 20 06, 89 : 12 67 - 12 79. Acta Veterinaria Scandinavica 20 09, 51: 36 http://www.actavetscan...
Ngày tải lên: 25/10/2012, 10:45
Tài liệu Báo cáo khoa học: Modulation of F0F1-ATP synthase activity by cyclophilin D regulates matrix adenine nucleotide levels pptx
... Street, A5 01, New York, NY 10 0 21 , USA Fax: + 21 2 000 0000 Tel: + 21 2 746 4534 E-mail: ans2 024 @med.cornell.edu (Received 9 June 2 010 , revised 22 January 2 011 , accepted 25 January 2 011 ) doi :10 .11 11/ j .17 42- 4658 .2 011 .08 026 .x Cyclophilin ... et al. Effect of CYPD on mitochondrial ATP flux rates FEBS Journal 27 8 (2 011 ) 11 12 11 25 ª 2 011 The Auth...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... Glu1 32 in A. thaliana PS. Val 111 and Gly 113 , on the other hand, are both affected by both pantoate and ATP. These residues have their positional equivalents in Val137 and Arg1 39 in A. thaliana ... 1. 06 His34 1. 10 Asp35 1. 75 Gly36 1. 74 Arg64 1. 89 Pro65 1. 32 Glu66 1. 57 Asp67 1. 45 Arg70 1. 10 Tyr 71 1. 02 Pro 72 1. 06 Thr74 1. 17 Leu75 1. 13 Gln76 1....
Ngày tải lên: 16/02/2014, 09:20