báo cáo khoa học: " Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein kinase C pathway in non-small cell lung cancer" pdf
... 30:6 http://www.jeccr.com/content/30/1/6 Page 8 of 10 RESEARC H Open Access Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein kinase C pathway in non-small cell lung cancer Honghe ... the lung, including atyp ical adeno - matous hyperplasia [3], adenocarcinoma [4], squamous cell carcinoma [5] and bronchiolar alveolar carcinoma [6...
Ngày tải lên: 10/08/2014, 10:20
... much of the work, and drafted the manuscript. Patient accrual and clinical data collection was done by all authors. XWC and JDZ participated in the analysis and the data interpretation. All authors ... morphological characteristics of permanent human small cell lung cancer cell lines. J Cancer Res Clin Oncol 1987, 113:31-40. 16. NCCN guidelines for small -cell lung cancer. [http://...
Ngày tải lên: 09/08/2014, 09:20
... Systems, Inc., Minneap olis, MN, USA). Plasma uPA activity was evaluated with a uPA Activity Assay kit (Chemicon International, Temecula, CA, USA). Statistical analysis Statistical analysis was performed ... II; CI, confidence interval; HR, hazard ratio; sVEGFR1, soluble vascular endothelial growth factor receptor 1; uPA, urokinase plasminogen activator; VEGF, vascular endothelia...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo khoa học: "Rib fracture after stereotactic radiotherapy on follow-up thin-section computed tomography in 177 primary lung cancer patients" potx
... analysis and drafting this paper. H.O carried out clinical data collection, supervision of this study, editing and approving the paper. S .A carried out clinical data collection, dosimetry calculation ... calculation and revision of clinical data. T.K, E.S and L.T carried out collection of CT data and clinical data. K.K, T.K, K.M, M .A, R.S and Y.M carried out clinical evaluations of pa...
Ngày tải lên: 09/08/2014, 09:21
Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx
... the molecular mechanism of the unfolding pathways. Currently, the unfolding pathway of a limited number proteins, such as bovine pancreatic trypsin inhi- bitor, RNaseA and a- lactoalbumin, have been ... thoroughly investigated. We have characterized the unfolding process of an artificial porcine insulin precursor (PIP), in which a dipeptide, AK, links the B and A chain, as shown in...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx
... monomeric G-actin i s a critical determinant for CTGF/CCN2 gene induction. These data indicate that distinct cytoskeletally based signaling events within the intracellular signaling machinery a ect ... 8B, expression of CTGF/CCN2 was not significantly affected in CA-RhoA-transfected cells but was nearly abrogated in CA-Cdc42-transfected cells indicating a preponderant role of p38 in...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: The CssRS two-component regulatory system controls a general secretion stress response in Bacillus subtilis pdf
... antibodies and anti-rabbit IgG conjugates (Biosource International, Camarillo, CA, USA). The alkaline phosphatase conjugate was detected using a standard NBT-BCIP reaction (Nitro Blue Tetrazolium ... htrB–lacZ expression were determined by analysing b-galactosidase (LacZ) activity (indicated in nmolÆmin )1 A À1 600 ) in cells grown in Luria–Bertani medium at 37 C. Samples were withd...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Insulin induces heme oxygenase-1 through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in renal cells pptx
... induces hypoxia-inducible factor 1-mediated vascular endothelial growth factor expression, which is dependent on MAP kinase and phosphatidylinositol 3 -kinase signaling in colon cancer cells. J Biol Chem ... real-time PCR was then performed using primers and probes specifically designed for human HO-1: forward primer 5¢-AGGGTGATAG AAGAGGCCAAGA, reverse primer 5¢-CAGCTCCTGCA ACTC...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Modulation of IMPDH2, survivin, topoisomerase I and vimentin increases sensitivity to methotrexate in HT29 human colon cancer cells docx
... 5¢-TTTGGCCTCATCTTCACTGAG-3¢ SURV for: 5¢-GGACCGCCTAAGAGGGCGTGC-3¢ 165 27 23–29 rev: 5¢-AATGTAGAGATGCGGTGGTCC-3¢ TOP1 for: 5¢-CAAGCAGCCCGAGGATGATC-3¢ 333 24 21–25 rev: 5¢-GCACTTTTCAGGTCTCTCCG-3¢ VIM ... 5¢-TCACGAGCCAG CAAGGCGTT-3¢ within intron 1 and 5¢-ACGCAGTACT CATCCAGGGT-3¢ within intron 2. The dhfr copy number was calculated according to the ratio of the dhfr and aprt signals for each MTX...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... GCAGCTGGACAGCTTCTGCC Speci c PCR on A. niger DNA gsd-2 1603–1584 (S78375 b ) CGTTCTTGGGCTCAATGGCG nctkt1 600–584 (NC4B12-T7 c ) GCCATTGATGCCGTCAA Speci c PCR on N. crassa DNA nctkt4 256–272 (NC4B12-T7 c ) ... wild-type and overexpressing strains were characterized in detail in exponential and sta- tionary phase of bioreactor cultures containing minimal media, with glu- cose as the...
Ngày tải lên: 07/03/2014, 17:20