Báo cáo y học: "The challenge to detect heart transplant rejection and transplant vasculopathy non-invasively a pilot study" ppsx
... citation purposes) Journal of Cardiothoracic Surgery Open Access Research article The challenge to detect heart transplant rejection and transplant vasculopathy non-invasively a pilot study Engin ... analysed. Zytological analyses This summarizes analyses of sputum, pharyngeal smear and urine to assess any bacterial, viral or fungal infections. Electrocardiogram A...
Ngày tải lên: 10/08/2014, 10:20
... the statistical analysis. MM, FA and TW participated in the experiments and data evaluation. HA and GZ conceived of the study, and participated in its design and coordination. All authors read and ... apoptosis is a very early event in myocardial injury. Caspase-3 has been shown to cleave the 112 kDa nuclear protein PARP into an 85 kDa apoptotic fragment [32], and this cleav...
Ngày tải lên: 10/08/2014, 09:21
... circulating DNA in plasma, appropriate sample handling is mandatory. RQ-PCR and ELISA techniques have applications in measuring circulating DNA. Assessment of circulatory DNA is a useful tool ... organ dysfunction and APACHE II (Acute Physiology and Chronic Health Evaluation II) scores, are needed to establish circulating DNA as a predictor for mortality and morbidity in patient...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"
... morbidity and mortality among patients in a medical emergency ward. Materials and methods Patient population All acutely hospitalised medical patients admitted to the medical emergency ward as well as ... symptoms including fever or hypothermia, tachycardia, tachypnoea and change in blood leucocyte count. The relationship between SIRS symptoms and morbidity and mortality in medi...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Surprising negative association between IgG1 allotype disparity and anti-adalimumab formation: a cohort study" doc
... data analysis and EG and MH in carrying out the immunoassays. GB, LA and GW participated in the interpretation of the data. All authors participated in the preparation of the manuscript and saw ... 68:1739-1745. 4. Miyasaka N: Clinical investigation in highly disease-affected rheumatoid arthritis patients in Japan with adalimumab applying standard and general evaluation: the CHANGE...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "An experimental model of rhinovirus induced chronic obstructive pulmonary disease exacerbations: a pilot study" pps
... tested, associated with evidence of viral replication and increased pro-inflammatory cytokines in nasal lavage. These were accompanied by significant increases in lower respiratory tract symptoms and reductions ... with peak lower respiratory tract symptoms on days 10 and 11. When the individual symptoms were analysed separately, all five lower respiratory symptom domains increased from...
Ngày tải lên: 12/08/2014, 16:20
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... GPVI was functional, we measured tyrosine phosphorylation of the FcR c-chain and the tyrosine kinase Syk, which is tyrosine phosphorylated and activated early after GPVI engagement. Phosphorylation ... collagen receptor present in platelets and megakaryocytes. It belongs to the superfamily of immunoblobulin receptors and is closely related to Fca receptor (FcaR) and natural kill...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo y học: "The Difficult-to-Control Asthmatic: A Systematic Approach" doc
...  2 agonists, and leukotriene modifiers, most patients with asthma are easily controlled and managed. However, approximately 5% of asthmatics do not respond to standard therapy and are classified ... the asthma as asthma and sudden exac- erbations are likely to cause anxiety and panic-like symptoms in the first place. Asthmatics with comorbid depression are especially difficult...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "The response to oestrogen deprivation of the cartilage collagen degradation marker, CTX-II, is unique compared with other markers of collagen turnove" doc
... synthesis is also examined. Materials and methods Healthy premenopausal and postmenopausal women Fifty healthy premenopausal women (age 30 to 40 years, mean age 35 years) and 50 healthy untreated postmenopau- sal ... subcutaneously and this dose was also given twice a day for two days. Ovariectomy was performed using a dorsal midline incision and the entrance into the abdomina...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "The tandem CCCH zinc finger protein tristetraprolin and its relevance to cytokine mRNA turnover and arthritis" pot
... UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAGCUCAUACUCCA MOUSE UAUUUAUAUAUUUAUAUUUUUUAAAUAUUUAUUUAUUUAUUUAUUUAA WOODCHUCK UAUUUAUAUAUUUAUACUUUUAAAAUAUUUAUUUAUUUAUUUAUUG COW UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAACUCAUACCCCA ... CAUUAUUAUUUAUUUAUUUAUUUAUUAUUUAUUUAC Woodchuck AAUUAUUUAUUACUUAUUUAUUAUUUAUUUAUUUAC ______ Rat GACUAUUUAUUUAUUAUUUAUUAUUUAUUUAUUUGC HUMAN UAUUUAUAUAUUUAU...
Ngày tải lên: 09/08/2014, 01:24