0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters Results of a 20-year single centre retrospective analysis" pptx

Báo cáo y học:

Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

... yearexperience in clinical treatment of thymomas as a result of a retrospective single centre analysis done within a Euro-pean university setting. The role of a pseudocapsula and its clinical significance ... metasta-sis in the liver. Recurrence was only seen in one case each in patients with an incomplete encapsulated thymoma or a missing capsula.Neo-Adjuvant and Adjuvant TherapyAs far as a neoadjuvant ... purposes)Journal of Cardiothoracic SurgeryOpen AccessResearch articleThe role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of...
  • 10
  • 355
  • 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGCQ76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTGReverse ... loop of cystatin A fulfils thesame function as the second binding loops of cystatin B and family 2 cystatins and also what residues of this loop in cystatin A may participate in the interaction.To ... representing thethird family, are glycosylated proteins of about 50–90 kDa.The single polypeptide chain of a kininogen contains threedomains resembling family 2 cystatins.Cystatins competitively inhibit...
  • 10
  • 533
  • 0
Báo cáo y học:

Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx

... -3'; β-actin, Sense: 5'-TGGAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'-TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ,Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAGCTTGTACCTTTACTTCACTG-3', ... domain5'-CAACACUCGCAAUAUU-3'(sense)3'-GUUGUGAGCGACGUUAUAA-5'(antisense)α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense)3'-UUUCCAGAAUACCACGACAGU-5'(antisense)Transmembrane domain5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense)3'-UUACACUACUUAUCCUCCACU-5'(antisense)Cytoplasmic ... domain5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense)3'-UUACACUACUUAUCCUCCACU-5'(antisense)Cytoplasmic membrane domain5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense)3'-UUAUCUCGAGACUAUCUAGAG-5'(antisense)Lee et al. Journal...
  • 12
  • 287
  • 0
Báo cáo y học:

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... ACGTTGGATGAGAGAACTGGGTTAAGGCAGrev ACGTTGGATGCCAGCACATCTTTTCACTCCACTCCATACCACTGGTCAGCTG 93.81ST+7 rs574174 G /A 0.19 0.19 fwd ACGTTGGATGCTGCCCTTGATGATTCCAAGrev ACGTTGGATGGGAACATCACAGGAAATGACACTGTCCCCATCCCATC ... ACGTTGGATGTTGCTCAGCCCCAAAGATGGCCCCACAGCCACTGGACAG 93.95V4 rs2787094 C/G 0.22 0.23 fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCCrev ACGTTGGATGTATGGTTCGACTGAGTCCACCTGAGTCCACACTCCCCTG 93.84Respiratory ... ACGTTGGATGAAAATACTGGGACTCGAGGCrev ACGTTGGATGTGCTGTATCTATAGCCCTCCACTCGAGGCCTGTGAATTCC 93.73M+1 rs3918395 G/T 0.15 0.13 fwd ACGTTGGATGGGGCACCAATTAACTAAGGCrev ACGTTGGATGTGAGGGCATGGAAGGTTCAGGCCGGCTCCCAAGCTCC...
  • 12
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot

... administration of anti-PLY antibodies pro-duces a marked decrease in inflammation, lung injury, and leukocyte infiltration. The interaction of PLY with TLR4 stimulates the inflammatory response in macro-phages ... animalexperimentation, tissue sample preparation and toxinquantification. RV participated in animal experimenta-tion. AA was involved in histopathological studies and image analysis. FV participated in ... by staining with anti-PLY rabbit antibodies. Apoptosis was assessed by active caspase-9 staining and in situ TUNEL assay. No staining was observed in lung tissues from uninfected mice. At 12...
  • 10
  • 350
  • 0
Báo cáo y học:

Báo cáo y học: " The role of recombination in the emergence of a complex and dynamic HIV epidemic" pptx

... central strain of that family than t o any otherfamily, including “ pure” subtypes, l ike the examplesshowninFigs.1,2,3.Eachfamilywouldbedefinedby a central se quetype and the radius of family memberswould ... recombinant lineage.This finding also corrects a recent claim that G is a recombinant and a descendant of CRF02, which was suggestedto be a pure subtype. The BC and BF recombinants in China and ... both old and contemporary subtype A and G. BF recombinants in South America and BC in China are new, as theirparents are contemporary sequences. The black blobs (recombinants) and grey blobs...
  • 15
  • 259
  • 0
Báo cáo y học:

Báo cáo y học: "The role of emergency medicine physicians in trauma care in North America: evolution of a specialty" pps

... ability to care for trauma patients and therefore the role of EMP's. Finally, EMP training and experience willaffect willingness and ability to care for trauma patients.Residency training in ... departments may be more likely to perform initialresuscitative care and transport the patient to a traumacenter. EMP's therefore may play a significant role in theinitial phase of trauma care as ... programsmight have a higher comfort level with trauma care thanthose whose training allows exposure to trauma only aspart of their general EM training, particularly if a separatetrauma team...
  • 6
  • 316
  • 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

... ThebF24rv mutagenic primer was 5¢-ATAAGTATACGCAGGCGCATACCAGCCAAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATCACACCATTATGACCAAAAACCAGCCCGGGATAGGC-3¢. The underlined codons ... may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and affinity of theenzyme for PAA and derivatives thereof, while maintainingthe hydrophobicity of ... using the methyl ester or the amide asacyl donor.It appeared that 6-APA and 7-ADCA were able toefficiently deacylate the phenylglycyl- and p-hydroxyphe-nylglycyl-enzyme of bF2 4A, as indicated...
  • 8
  • 561
  • 0

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ