Báo cáo y học: "Spectrum of peripheral neuropathies associated with surgical interventions; A neurophysiological assessment" pot
Báo cáo y học: "Treatment of proximal femur infections with antibiotic-loaded cement spacers"
... maintenance of the joint function and the infection eradication are the treatment aims of bacte- rial infections of the proximal femur and its bordering soft tissues. In case of early infections of ... the aim of this study was to evaluate the efficacy of antibiotic-impregnated spacers in the treatment of proximal femur infections. In 10 consecutive patients (...
Ngày tải lên: 26/10/2012, 09:53
Báo cáo y học: "Management of Critically Ill Patients with Severe Acute Respiratory Syndrome (SARS)"
... Acute Respiratory Distress Syndrome in Critically ill patients with severe acute respiratory syndrome. JAMA, 2003. 290:374-380. 40. Wong VWS., et al. Treatment of severe acute respiratory syndrome ... critically- ill patients with severe acute respiratory syndrome. JAMA, 2003. 290:374-80. 65. Gomersall C.D., et al. Short-term outcome of critic...
Ngày tải lên: 03/11/2012, 10:20
Báo cáo Y học: Regulation of stress-activated protein kinase signaling pathways by protein phosphatases pot
... in the regulation of yeast SAPK pathways, then fo cus on the properties of the protein phosphatases implicated in the mammalian SAPK systems. REGULATION OF SAPK SIGNAL PATHWAYS BY PROTEIN PHOSPHATASES ... MINIREVIEW Regulation of stress-activated protein kinase signaling pathways by protein phosphatases Shinri Tamura, Masahito Hanada, Motoko Ohnishi,...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx
... retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells Mi-Ock Lee 1, *, Hyo-Jin Kang 1, *, Young Mi Kim 1 , Ji-Hyun Oum 2 and ... have not been elucidated. Nuclear factors of activated T-cells (NFAT) is a family of related transcription factors that play a c entral rol...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx
... mixture of single enzymes. Some examples are D -hydantoinase/N-carbamylase [7], b-galactosidase/galac- tokinase [8], citrate synthase/ malate dehydrogenase [9], aminocyclopropane-carboxylic acid synthase/ aminocyclo- propane-carboxylic ... will make fusions of FPPS and ADS and introduce the bifunctional enzyme into plants of A. annua. We expect to obtain an increased biosynthesi...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học:Association of the thyrotropin receptor with calnexin, calreticulin and BiP Effects on the maturation of the receptor docx
... 4935 Association of the thyrotropin receptor with calnexin, calreticulin and BiP Effects on the maturation of the receptor Sandrine Siffroi-Fernandez*, Annie Giraud, Jeanne Lanet and Jean-Louis ... from the association of the V2 vasopressin receptor with calnexin (CNX) and calreticulin (CRT), and that of the gonadotropin receptor with...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... CCATGCCTATGATACTGGGAT-3Â GSTM1-revA 5Â- CTAAAGATGAGACAGGCCTGG-3Â GSTM1-revB 5Â-GATCCTAAAGATGAGACAGGCCTGG-3Â GSTM2-forA 5Â-AATTCGATGCCTATGACACTGGGTTAC-3Â GSTM2-forB 5Â- CGATGCCTATGACACTGGGTTAC-3Â GSTM2-revA ... 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGTA GAGCTTCATCTTCTC CDS 397–426 – 1 AS-8 ACTGGTCAAGAATGTCATAA CDS 480–499 – 7 AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0 AS-10 CA...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA" ppsx
... article Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA Charles J Cox 1 , Karen E Kempsell 2 and J S Hill Gaston 1 1 Department of Rheumatology, University ... Rothfuss S, et al.: Surveying for evidence of synovial Chlamydia trachomatis by polymerase chain reaction (PCR) . A study of 411 synovial biops...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Lack of autoantibody production associated with cytomegalovirus infection" pdf
... ribonucleoprotein (U1 snRNP) associated with cytomegalovirus infection. Arthritis Res 2001, 3:253-258. 15. Adler SP, McVoy M: Detection of cytomegalovirus antibody by enzyme immunoassay and lack of evidence for ... which cross-react with virus and cardiac myosin: a model for the study of molecular mimicry in the pathogenesis of viral myocarditis. Immunology 1992, 75:513-519....
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx
... reported and replicated with rheumatoid arthritis (RA) in Japanese populations. The aim of this study was to investigate association of the FCRL3 gene with RA in UK subjects. DNA was available from ... article Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity? Stephen Eyre, John Bowes, Catherine Potte...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Spectrum of peripheral neuropathies associated with surgical interventions; A neurophysiological assessment" pot
... associated with surgical interventions; A neurophysiological assessment Shiv Saidha*, Jennifer Spillane, Gerard Mullins and Brian McNamara Abstract Background: We hypothesized that a wide range of ... 5:9 http://www.jbppni.com/content/5/1/9 Page 3 of 4 neuropathy) and coronary angiography (1 median neu- ropathy contralateral to the side of arterial cannulation). Sciatic...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Implication of human papillomavirus-66 in vulvar carcinoma: a case report" potx
... underwent radical vulvectomy and bilateral inguinal lymphadenectomy for a vulvar carcinoma. A human papillomavirus infection was suggested on the basis of histological and cytological examinations ... Terceira island. Infect Agent Cancer 2008, 3:6. 11. Garc a- Sierra N, Martró E, Castellà E, Llatjós M, Tarrats A, Bascuñana E, Díaz R, Carrasco M, Sirera G, Matas L, Ausina V: Evaluat...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: " Adult granulosa cell tumor associated with endometrial carcinoma: a case report" pps
... hospital. Discussion Adult granulosa cell tumors account for approximately 95% of all granulosa cell tumors [1]. We have yet to record any case of a juvenile granulosa cell tumor at our center. Adult ... demon- strated by a choriocarc inoma or yolk sac tumor. How- ever, they can also produce other placental hormones, such as placental alkaline phosphatase and lactate...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo y học: " Risk of malnutrition is associated with mental health symptoms in community living elderly men and women: The Tromsø Study" pdf
... this article as: Kvamme et al.: Risk of malnutrition is associated with mental health symptoms in community living elderly men and women: The Tromsø Study. BMC Psychiatry 2011 11:112. Submit your ... for the association between mental health problems (in four categories) and the risk of malnutrition (combining medium and high risk) in...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Identification of host proteins associated with HIV-1 preintegration complexes isolated from infected CD4+ cells" potx
... immunoblotting of SupT1-H9 and SupT1-H9/HTLVIIIB samples confirming the host proteins that specifically associated with HIV-1 PICs. Of the host proteins identified here to be specifically associated with HIV-1 ... the proteins sel ectively co-purifying with PICs have been analyzed by mass spectrometry. This technology enabled us to reveal at least 19 host protei...
Ngày tải lên: 13/08/2014, 01:20