Báo cáo y học: "A rare cause of forearm pain: anterior branch of the medial antebrachial cutaneous nerve injury: a case report" pdf
... Peripheral Nerve Injury Open Access Case report A rare cause of forearm pain: anterior branch of the medial antebrachial cutaneous nerve injury: a case report Necmettin Yildiz and Füsun Ardic* Address: ... neu- ropathy of the posterior branch of the MACN are abun- dant [2,4-6] only one case caused by lipoma has been found to describe the a...
Ngày tải lên: 10/08/2014, 10:20
... CAS E REP O R T Open Access Paresthesia and forearm pain after phlebotomy due to medial antebrachial cutaneous nerve injury Mahsa Asheghan * , Amidoddin Khatibi and Mohammad Taghi Holisaz Abstract Back ... mahsaasheghan@yahoo.com Department of Physical Medicine and Rehabilitation, Baghyatollah Hospital, Baghyatollah University of Medical Sciences, Mollasadra Street, Tehran, Iran...
Ngày tải lên: 10/08/2014, 10:20
... crystal plates was sufficient for further analyses. Unfortunately, X-ray analyses of such plates were unsuccessful because the diffraction of the crystals decreased very rapidly during the measurements. ... sponta- neous mutation of a phycocyanin gene because two special lyases are involved in the synthesis and attachment of the chromophore [33,34]. Concerning the light h...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo y học: "Collaboration between general hospitals and community health services in the care of suicide attempters in Norway: a longitudinal study" ppt
... manuscript. Acknowledgements The study was supported by a grant from the Directorate of Health and Social Affairs, Norway. Mork et al. Annals of General Psychiatry 2010, 9:26 http://www.annals-general-psychiatry.com/content/9/1/26 Page ... Norway Full list of author information is available at the end of the article Mork et al. Annals of General Psychiatry 2010, 9:26 http...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
... 2:116-126. 20. Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and anti-CD3 antibody. A synergistic effect medi- ated by the VLA-5 fibronectin ... were then isolated by FACS (MoFlo; Cytomation). The purity of the cells was greater than 99%. Generation of cytotoxic T lymphocyte lines (mixed lymphocyte cultur...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα ... AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG C...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... Huntsville, AL USA). The primer sequences used were: for β-actin, for- ward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAG- CAACTCCAGAA. ... infliximab treatment could be that HMGB1 may be more dependent on the IL-1 pathway than the TNF pathway in the pathogenesis of arthritis. This theory is also supported b...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... Institutional Animal Care and Use Committee. Autoantigen microarrays Antigens were printed in ordered arrays on FAST slides (Whatman, now part of GE Healthcare, Piscataway, NJ, USA). Arrays were ... sensitivity of naive B cells via type I IFN. J Immunol 2005, 174:4043-4050. 49. Hanada T, Yoshida H, Kato S, Tanaka K, Masutani K, Tsukada J, Nomura Y, Mimata H, Kubo M, Yoshimura A: Suppre...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Half-dose verteporfin photodynamic therapy for bullous variant of central serous chorioretinopathy: a case report" doc
... interpreted the patient data and wrote the first draft of the manuscript. ZHYW had a role in writing a final draft of the manuscript and in the preparation of clinical images. TYYL performed the treatment ... fibrinous exudates and retinal pigment epithelial (RPE) changes without retinal break (Figure 1A) . An examination of the anterior segment and vitreous c avit...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: " Renal cell carcinoma metastasizing to solitary fibrous tumor of the pleura: a case report" ppt
... follicular variant of papillary carcinoma of thyroid. Arch Pathol Lab Med 1999, 123:703-706. 9. Han HS, Kim EY, Han JY, Kim YB, Hwang TS, Chu YC: Metastatic renal cell carcinoma in a meningioma: a case ... alternating hypercellular and hypocellular areas and characteristic branching, staghorn vessels which may captivate blood- borne metastases, as in the case of renal cell car...
Ngày tải lên: 10/08/2014, 23:21