Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps
Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps
... this article as: Shimamoto: Polyurethane sheet: A potential substitute of surgical cotton gauze. Journal of Cardiothoracic Surgery 2011 6:26. Submit your next manuscript to BioMed Central and take ... study indicates that the blood absorption power of the polyurethane sheet is equivalent to that of the cotton gauze even after repeated use, and it has the potential to d...
Ngày tải lên: 10/08/2014, 09:23
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx
... legal representatives. Biomarker evaluations In the PROWESS trial, plasma samples were obtained at baseline (day of randomization) and daily through to study day 7. A central laboratory (Covance Central Laboratory Services, Indianapolis, ... prevailing assumed mechanism of action of PC was anticoagulation, and so the laboratory measurements in that study focused primarily on the coagu...
Ngày tải lên: 13/08/2014, 08:21
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... the analyzer Cobas Integra (Roche Diagnostics, Mannheim, Germany). The limits of detection were 0.071 mg/dl. Statistical analyses Data are presented as the mean ± standard deviation for vari- ables ... refer- ral venue for habitants in Western-North Morocco. The 12-bed medical ICU admits approximately 550 patients annually with an average age of 40 years. Surgery patients, coronary patien...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... the same (syngenic) laboratory animal strain as the target animal, contain homology blocks that are genetically identical (or virtually identical) to the target homology regions. Riele et al ... likely that human germline gene therapy will remain insufficiently safe, excessively inefficient and of inadequate clinical value to permit its use. The widespread availability and applicability...
Ngày tải lên: 03/11/2012, 10:01
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... cells Kentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa 1 Faculty of Pharmaceutical Sciences, University of Tokushima, Japan The effect of a- tocopheryl hemisuccinate ... Fukuzawa, Faculty of Pharmaceutical Sciences, University of Tokushima, Shomachi-1, Tokushima 770-8505, Japan. Fax: + 81 88 633 9572, E-mail: fukuzawa@ph.tokushima-u.ac.jp...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc
... Gerassimos N. Pagoulatos and Charalampos E. Angelidis Laboratory of General Biology, Medical School, University of Ioannina, Greece Dj2 is a member of the DnaJ family of proteins, which regulate ... The library was screened using the entire hudj2 cDNA as a probe. Library Correspondence to A. E. Charalampos, University of Ioannina, Medical School, Laboratory of General Biology...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo y học: " Ambivalent connections: a qualitative study of the care experiences of non-psychotic chronic patients who are perceived as ‘difficult’ by professionals" docx
... Behavioral Analysis System of Psychotherapy (CBASP) New York, Guilford; 2003. 31. Sumathipala A, Siribaddana S, Hewege S, Sumathipala K, Prince M, Mann A: Understanding the explanatory model of the ... paragraph. Iamafraidthatitisamixtureofmyownparanoia and hostility towards health professionals, and the way I interpret what they say. And the interaction that comes from this. ( .). Plu...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx
... 62:455-457. 31. Ahmad S, Mustafa AS, Khan Z, Al-Rifaiy AI, Khan ZU: PCR-enzyme immunoassay of rDNA in the diagnosis of candidemia and comparison with amplicon detection by agarose gel electrophoresis. ... 7:236 http://www.virologyj.com/content/7/1/236 Page 2 of 6 RESEARC H Open Access Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait Ajmal D...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "Early biomarkers and potential mediators of ventilation-induced lung injury in very preterm lambs" ppt
... CTGTGAGAGGAGGTGGAGAG IL-6 NM_001009392 598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCA IL-8 NM_001009401 438–520 CCTCAGTAAAGATGCCAATGA TGACAACCCTACACCAGACC 18S X01117 1495–1673 GTCTGTGATGCCCTTAGATGTC ... GCAGCTGAAGTCAAAGGAA CTGF DQ239672 407–469 TATAGCTCCAGCGACAGCTC ACGAACTTGACTCAGCCTCA CYR61 DQ239628 286–354 ATCGTCCAAACAACTTCGTG GGTAACGCGTGTGGAGATAC IL-1 NM_001009465 353–473 CGATGAGCTTCTGT...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Arsenic trioxide, a potent inhibitor of NF-κB, abrogates allergen-induced airway hyperresponsiveness and inflammation" pot
... ECA, and ELISA. XFC performed the EMSA and Western blot analysis. WPX conducted the airway physiology, lung histology, and partial data analysis. AHH gave helpful advice for data analysis and ... activation [1,5,39-42]. Abbreviations AHR, Airway hyperresponsiveness; ANOVA, One-way analysis of variance; APL, Acute promyelocytic leukemia; As 2 O 3 , Arsenic trioxide; ATRA, All-trans retinoic...
Ngày tải lên: 12/08/2014, 16:20