Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps
Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps
... this article as: Shimamoto: Polyurethane sheet: A potential substitute of surgical cotton gauze. Journal of Cardiothoracic Surgery 20116:26.Submit your next manuscript to BioMed Centraland take ... study indicates that the blood absorption power of the polyurethane sheet is equivalent to that of the cotton gauze even after repeated use, and it has the potential to decrease the total amount ... war-ranted, polyurethane sheets may function as a substitute of conventional surgical gauze, thus facilitating a moreefficient surgery.Competing interestsNone: Dr.Shimamoto has no commercial...
- 2
- 237
- 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx
... legalrepresentatives.Biomarker evaluationsIn the PROWESS trial, plasma samples were obtained atbaseline (day of randomization) and daily through to study day7. A central laboratory (Covance Central Laboratory Services,Indianapolis, ... prevailing assumed mechanism of action of PC was anticoagulation, and so the laboratory measurementsin that study focused primarily on the coagulation pathway.Many of the potential biomarkers ... organ dysfunctions were systematicallyanalyzed to identify a potential surrogate end-point formonitoring DrotAA therapy and predicting 28-day mortality atthe end of therapy. To allow comparison...
- 11
- 343
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... the analyzer Cobas Integra (RocheDiagnostics, Mannheim, Germany). The limits of detectionwere 0.071 mg/dl.Statistical analysesData are presented as the mean ± standard deviation for vari-ables ... refer-ral venue for habitants in Western-North Morocco. The 12-bedmedical ICU admits approximately 550 patients annually withan average age of 40 years. Surgery patients, coronarypatients, neonates ... properties of the short form 36 and health-related quality of life after intensive care in Morocco. Acta Anaesthesiol Scand2007, 51:189-197.27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal...
- 10
- 597
- 0
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... the same (syngenic) laboratory animal strain as the target animal, contain homology blocks that are genetically identical (or virtually identical) to the target homology regions. Riele et al ... likely that human germline gene therapy will remain insufficiently safe, excessively inefficient and of inadequate clinical value to permit its use. The widespread availability and applicability ... have a failure rate of more than 50%. The only feasible way that pre-screening might work at an acceptable level of efficiency would be to screen blastocyst-stage embryos. However, blastocyst...
- 16
- 506
- 1
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... cellsKentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa1Faculty of Pharmaceutical Sciences, University of Tokushima, JapanThe effect of a- tocopheryl hemisuccinate ... Fukuzawa, Faculty of PharmaceuticalSciences, University of Tokushima, Shomachi-1,Tokushima 770-8505, Japan.Fax: + 81 88 633 9572,E-mail: fukuzawa@ph.tokushima-u.ac.jpAbbreviations: AsA, ascorbic ... Tokumura, A. , Iimori, M., Nishioka, Y. , Kitahara, M., Sakashita,M. & Tanaka, S. (1994) Lysophosphatidic acids induce pro-liferation of cultured vascular smooth muscle cells from rat aorta.Am....
- 6
- 494
- 0
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc
... Gerassimos N. Pagoulatos and Charalampos E. AngelidisLaboratory of General Biology, Medical School, University of Ioannina, GreeceDj2 is a member of the DnaJ family of proteins, whichregulate ... The library wasscreened using the entire hudj2 cDNA as a probe. LibraryCorrespondence to A. E. Charalampos, University of Ioannina,Medical School, Laboratory of General Biology, Ioannina, 45110.Fax: ... conformation states [17]. Finally, overexpres-sion of dj2 was recently found to decrease aggregateformation caused by expanded polyglutamine tracts, a hallmark of neurodegenerative diseases [21,22].In...
- 8
- 468
- 0
Báo cáo y học: " Ambivalent connections: a qualitative study of the care experiences of non-psychotic chronic patients who are perceived as ‘difficult’ by professionals" docx
... BehavioralAnalysis System of Psychotherapy (CBASP) New York, Guilford; 2003.31. Sumathipala A, Siribaddana S, Hewege S, Sumathipala K, Prince M, Mann A: Understanding the explanatory model of the ... paragraph.Iamafraidthatitisamixtureofmyownparanoiaand hostility towards health professionals, and theway I interpret what they say. And the interactionthat comes from this. ( .). Plus that they have t hispanic-like ... led the data collection, analysis, and prepared the manuscript.BvM, AK, AS and GH co-drafted the manuscript. All had full access to alldata. All authors read and approved the final manuscript.Competing...
- 11
- 369
- 0
Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx
... 62:455-457.31. Ahmad S, Mustafa AS, Khan Z, Al-Rifaiy AI, Khan ZU: PCR-enzymeimmunoassay of rDNA in the diagnosis of candidemia and comparisonwith amplicon detection by agarose gel electrophoresis. ... 7:236http://www.virologyj.com/content/7/1/236Page 2 of 6RESEARC H Open AccessEchoviruses are a major cause of asepticmeningitis in infants and young childrenin KuwaitAjmal Dalwai, Suhail Ahmad, Widad Al-Nakib*AbstractBackground: ... thatcould detect as few as 50 copies of enteroviral genome[16] and the reproducibility of the assay was periodicallychecked by both internal as well as external NationalExternal Quality Assurance...
- 6
- 285
- 0
Báo cáo y học: "Early biomarkers and potential mediators of ventilation-induced lung injury in very preterm lambs" ppt
... CTGTGAGAGGAGGTGGAGAGIL-6 NM_001009392598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCAIL-8 NM_001009401438–520 CCTCAGTAAAGATGCCAATGA TGACAACCCTACACCAGACC18S X011171495–1673 GTCTGTGATGCCCTTAGATGTC ... GCAGCTGAAGTCAAAGGAACTGF DQ239672407–469 TATAGCTCCAGCGACAGCTC ACGAACTTGACTCAGCCTCACYR61 DQ239628286–354 ATCGTCCAAACAACTTCGTG GGTAACGCGTGTGGAGATACIL-1 NM_001009465353–473 CGATGAGCTTCTGTGTGATG CTGTGAGAGGAGGTGGAGAGIL-6 ... Speer CP:Association of pulmonary inflammation and increasedmicrovascular permeability during the development of bronchopulmonary dysplasia: a sequential analysis of inflam-matory mediators in...
- 15
- 264
- 0
Báo cáo y học: " Arsenic trioxide, a potent inhibitor of NF-κB, abrogates allergen-induced airway hyperresponsiveness and inflammation" pot
... ECA, and ELISA. XFC performed the EMSAand Western blot analysis. WPX conducted the airwayphysiology, lung histology, and partial data analysis. AHHgave helpful advice for data analysis and ... activation[1,5,39-42].AbbreviationsAHR, Airway hyperresponsiveness; ANOVA, One-wayanalysis of variance; APL, Acute promyelocytic leukemia;As2O3, Arsenic trioxide; ATRA, All-trans retinoic acid;BALF, Bronchoalveolar ... findings not only prove an essentialrole of NF-κB-mediated airway inflammation, but alsoillustrate the importance of alternative signaling pathwayand additional cell types in the airways, and the...
- 12
- 340
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015