Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx
Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx
... during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis Kristin K Haga 1* , Katie L McClymont 1 , Scott Clarke 1 , Rebecca S Grounds 1 , Ka Ying ... control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis. Journal of Cardi...
Ngày tải lên: 10/08/2014, 09:23
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf
... Mitsuuchi. Y. , Toda, K., Miyahara, K., Yokoyama, Y. , Nakao, K., Hosoda, K., Y amamoto, Y. , I mura, H. & Shizuta, Y. (1990) Cloning of cDNA and genomic DNA for human c ytochrome P-45011 beta. FEBS ... cardiovascular or endocrine diseases, Fig.3.Assessmentof11b-h ydroxylase a ctivity and determination of 11b-hydroxylase capacity. (A) Assessmentof11b-hydroxylase activity...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "The effect of high correlated colour temperature office lighting on employee wellbeing and work performance" ppt
... m. Each work area has dark floors and white walls. Floors have windows on approximately 80% of both their East and West wall areas. Blinds are present and used in such a way that typically more ... for the study. Authors' contributions PM developed the study protocol, collected the data and contributed to data analysis and writing of the manu- script. ST analysed the da...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo hóa học: " The effect of an autologous cellular gel-matrix integrated implant system on wound healing" pot
... Facultad de Farmacia, Universidad de Valparaíso, Avenida Gran Breta a 1093, Playa Ancha Valparaíso, Casilla 5001-V, Valparaíso, Chile, 2 Departamento de Ciencias Farmacéuticas, Facultad de Farmacia, ... Santa Mar a, Casilla 110-V, Valparaíso, Chile, 5 Facultad de Ciencias Naturales y Exactas, Universidad de Playa Ancha de Ciencias de la Educación Avenida Leopoldo Carvallo 270, Play...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo y học: " Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis" pptx
... OPG.for OPG.rev 5'-AGAGCAAACCTTCCAGCTGC-3' 5'-CGCTGCTTTCACAGAGGTCA-3' RANK AF19046 1422–1440 RANK.for RANK.rev 5'-TGCCTACAGCATGGGCTTT-3' 5'AGAGATGAACGTGGAGTTACTGTTT3' RANKL ... intestinal peptide and pituitary adenylate cyclase-activating polypeptide on osteoclast forma- tion are associated with upregulation of osteoprotegerin and downregulation...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Therapeutic effect of the potent IL-12/IL-23 inhibitor STA-5326 on experimental autoimmune uveoretinitis" pot
... mg/kg STA-5326 (Synta Pharmaceuticals Corporation, Lexington, MA) or vehicle only (0.5% carboxyl methyl cellulose) was orally administered once a day for six days a week from day 0 to day 14 after ... severity was evaluated on day 15 and day 18 after immunization. Fundus examination revealed that STA- 5326 treatment significantly reduced the severity of EAU on day 15 (Figure 4...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "Beneficial effect of the oxygen free radical scavenger amifostine (WR-2721) on spinal cord ischemia/reperfusion injury in rabbits" docx
... [22-24]: a) mitochondrial dysfunc- tion, leading to a failure of aerobic energy metabolism and lactate accumulation, b) activation of mitochondrial and cytoplasmic nitric oxide synthase (NOS) and ... chemo-attractants for polymorphonuclear leukocyte and macrophage influx, and) activation of the calcium-activated cysteine protease calpain which is mediating axonal damage in S...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... of vital (life threatening) danger possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, ... was classified (table 2). The NACA score system was chosen because it is easy to use retrospectively and the air ambulances use Zakariassen et al. Scandinavian Journal of Trauma, Resusc...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"
... University of Calgary, Calgary, AB T2N 2T9, Canada 3 Department of Medicine, University of Calgary, Calgary, AB T2N 2T9, Canada 4 Alberta Kidney Disease Network, Calgary, AB T2N 2T9, Canada 5 Calgary ... of ICU-acquired hyponatraemia and hypernatraemia varies according to patient characteris- tics. • ICU-acquired hyponatraemia and hypernatraemia are associated with increased r...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... ra- tionale after the initiation of NARP. Also carbapenem resistance rates of Pseudomonas spp and Acinetobacter spp decreased correlating with decreased consump- tion of carbapenems after NARP ... of boxes were calculated from two databases, 1) Hospital pharmacy computer data- bases, and 2) International Medication System (IMS). Because Turkey is an inflation country we ha...
Ngày tải lên: 25/10/2012, 11:00