Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx

... with these valves. We descr ibe distortion of the bioprosthesis ring as a risk factor for early calcification. Methods: A total of 510 patients over the age of 70 years underwent isolated aortic ... valves [3]. We describe distortio n of the bio- prosthesis ring as a risk factor for early calcification. Materials and methods A total of 510 patie...

Ngày tải lên: 10/08/2014, 09:22

... to the set of distances. The main advantages of the procedure are simple: the details of the calibration are precisely and unambiguously defined, it is fully automatic, and the family of calculated ... H., Komurasaki, T., Uchida, D., Takayama, Y. , Isobe, T., Okuyama, T. & Hanada, K. (1995) Epiregulin. A novel epidermal growth factor with mitogenic activity for...

Ngày tải lên: 22/02/2014, 07:20

... however, hypothetically accommodates dysfunctional and destructive actions of the mediators, leading to secondary organ damage and even death. This set of events is theoretically also applicable to ... defined as the loss of cortical definition of the proximal interphalangeal, metacarpophalangeal, carpal, interphalan- geal, and metatarsophalangeal joints was documented: a si...

Ngày tải lên: 09/08/2014, 13:22

... propionyl- CoA carboxylase; AAC, ATP/ADP translocator; ACP, acyl carrier protein; ALAT, alanine aminotransferase; BC-AAT, branched-chain amino acid aminotransferase; C I, complex I; ECH, enoyl-CoA hydratase; ... 3- hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrier protein; Pyr C, pyruvate carboxylase; SCS, suc...

Ngày tải lên: 09/08/2014, 22:24

... surgery the right atrial appendage was noted to be very congested and “angry looking” . Total cardiopulmonary bypass was established using aortic and bi-caval cannula- tion. The right atrial cavity ... adjuvant multimodality therapy along with a tumor surveillance program may improve survival. Introduction Primary cardiac malignancies (PCM) are rare. The preva- lence of primary card...

Ngày tải lên: 10/08/2014, 09:22

... papillary fibroelastoma of the aortic valve in a young woman -a case report. Cardiovascular Ultrasound 2009, 7:43. 9. Sato Y, Yokoyama H, Satokawa H, Takase S, Maruyama Y: A report of a surgical case ... two cases and review of the literature. Annals of Clinical & Laboratory Science 2001, 31(3):291-296. 8. Parthenakis F, Nyktari E, Patrianakos A, Pitsis A, Asimaki...

Ngày tải lên: 10/08/2014, 09:22

... consent was obtained from the patient for publication of this Case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. References 1. ... Flow voids are usually apparent and feeding vessels may be vis- ualized; these lesions are also noted to enhance after Gd- addition. On angiography an early and...

Ngày tải lên: 10/08/2014, 10:20

... Mathematically this was achieved by introducing a Ôfree mixing factor ( fm) to the rate equation for exogenous arginine hydrolysis by arginase in the Mathematica program; fm can take any value ... and necessarily complex, mathematical models serves as a ÔtoolÕ to facilitate analysis of channelling in biochemical pathways like the urea cycle. There is a range of possible m...

Ngày tải lên: 08/03/2014, 08:20

... GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 [48] Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen ... and particularly during inflammatory phases. Very often, these phases lead to hyperplasia of the synovium, which may invade the joint space and adhere to car- tilage, gener...

Ngày tải lên: 09/08/2014, 10:20

... quan- titatively analyzed the mRNA expression level of RIZ1 over the disease progression in eight different types of cancer, and evaluated the anticancer activity of the PR domain against human hepatoma ... apoptosis in the early stages and a tumor promoter to induce me- tastasis in late stages. If this hypothesis were proved valid, the net result of RIZ1’s apparent...

Ngày tải lên: 25/10/2012, 11:15