Báo cáo y học: "Microsurgical technique in obstetric brachial plexus repair: a personal experience in 200 cases over 10 years " doc
Báo cáo y học: "Microsurgical technique in obstetric brachial plexus repair: a personal experience in 200 cases over 10 years." doc
... repair: a
personal experience in 200 cases over 10 years
Jörg Bahm*, Claudia Ocampo-Pavez and Hassan Noaman
Address: Euregio Reconstructive Microsurgery Unit, Franziskushospital Aachen, Germany
Email: ... Central
Page 1 of 7
(page number not for citation purposes)
Journal of Brachial Plexus and
Peripheral Nerve Injury
Open Access
Methodology
Microsurgical technique...
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... chains [8].
In the autoxidation reaction of HbO
2
,aswellasMbO
2
,
pH can affect the rate in many d ifferent ways. Recent kinetic
and thermodynamic studies of the stability of mammalian
oxymyoglobins ... spectra of the
separa ted bO
2
chain must be most informative if available,
because the autoxidation reaction of the b chain contains a
very strong proton-catalysis in the isolated fo...
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... that
antibodies may interact directly with fibroblast-like cells
and through this interaction form part of a signalling loop
that ultimately results in the maintenance of local
inflammation. Consequently, ... directly to the
pathogenesis of synovial inflammation and joint
destruction has seen a ‘revival’ over the last couple of
years [6,7]. This is mainly due to the observation that...
Báo cáo y học: "Surgical outcomes of the brachial plexus lesions caused by gunshot wounds in adults" pdf
... http://www.jbppni.com/content/4/1/11
Page 5 of 10
(page number not for citation purposes)
Pain Management in Brachial Plexus Injuries
Injury to the brachial plexus may cause severe pain. Intrac-
table pain was assigned in 5 cases ... Brachial plexus injury: a survey of 100
consecutive cases from a single service. Neurosurgery 2002 ,
51(3):673-82.
29. Matsuyama T,...
Báo cáo y học: "Dominance of highly divergent feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma" pdf
... 9) and with (n = 18) apparent lymphoma. C) Viral (cDNA) FeLV -A/ Glasgow-1 and env variant loads in all tissues. D) Viral
(cDNA) env variant loads in tissues with and without apparent lymphoma. ... progeny
viruses from t he originally inoculated FeLV -A/ Glas-
gow-1foundincat#261maybeexplainedbythelong
period (8.5 years) during which the virus had time to
evolve in this cat. This, in...
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... AGGTGCTTT AAGAATAGTT
TTT/AAAAACTATT CTTAAAGCAC CTACCAAGCC
TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA-
TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC
CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG
CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT-
TAAGGCAGCACCTACCAAGCCTC,695+ 3A, ... TTGCTGTAC/GTACAGCAAAAAC-
TATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT
CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAA-
TAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG
CTAAACCTACCAAGC,695...
Báo cáo y học: "Mathematical modeling of the socalled Allis test: a field study in orthopedic confusion" docx
... feet. Asymmetry in distal foot positions
resulting from an actual discrepancy in the length of the
lower extremities is generally called anatomical leg length
inequality (aLLI). Apparent asymmetry ... GA: Anatomic and functional leg-length inequality: A
review and recommendation for clinical decision-making. Part I,
anatomic leg-length inequality: prevalence, magnitude, effects
and clin...
Báo cáo y học: "Parents'''' assessment of parent-child interaction interventions – a longitudinal study in 101 families" docx
... 71118
3 years 6101 6
4 years 4101 4
5 years 4711
6 years 167
7 years 246
8 years 156
9 years 213
10 years 415
11 years 033
12 years 202
Child's residence (n = 101 families)
Mother & Father ... Interaction;(AVAT) Availability of attachment; (ADAT) Adequacy of attachment; (AVSI) Availability of social integration;
(ADSI) Adequacy of social integration. High valu...
Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx
... ted only in carcino-
mas, in 45 cases the transcript was expressed only in
carcinomas and not in normal tissue. This may be due
to activation of signaling pathways not expressed in
normal skin, ... in carcinomas, a table detailing cis-
and trans-eQTL counts, a table listing genes altered more than two
standard deviations from the mean in carcinomas compared to matched
norm...
Báo cáo y học: " Massive penoscrotal haematoma following inguinal hernia repair: a case report" docx
... a drain in huge inguinal hernia repair and
in doubtful haemostasis but we admit that our patient suf-
fered from only a moderate sized inguinal hernia. One
may argue that if we had used a drain ... not necessarily require
ultrasound. In cases of huge scrotal haematoma or unre-
solving haematoma, surgical drainage may be necessary.
Massive penoscrotal haematoma is not uncommon i...