Báo cáo y học: "Microsurgical technique in obstetric brachial plexus repair: a personal experience in 200 cases over 10 years " doc
Báo cáo y học: "Microsurgical technique in obstetric brachial plexus repair: a personal experience in 200 cases over 10 years." doc
... repair: a personal experience in 200 cases over 10 years Jörg Bahm*, Claudia Ocampo-Pavez and Hassan Noaman Address: Euregio Reconstructive Microsurgery Unit, Franziskushospital Aachen, Germany Email: ... Central Page 1 of 7 (page number not for citation purposes) Journal of Brachial Plexus and Peripheral Nerve Injury Open Access Methodology Microsurgical technique...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... chains [8]. In the autoxidation reaction of HbO 2 ,aswellasMbO 2 , pH can affect the rate in many d ifferent ways. Recent kinetic and thermodynamic studies of the stability of mammalian oxymyoglobins ... spectra of the separa ted bO 2 chain must be most informative if available, because the autoxidation reaction of the b chain contains a very strong proton-catalysis in the isolated fo...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... that antibodies may interact directly with fibroblast-like cells and through this interaction form part of a signalling loop that ultimately results in the maintenance of local inflammation. Consequently, ... directly to the pathogenesis of synovial inflammation and joint destruction has seen a ‘revival’ over the last couple of years [6,7]. This is mainly due to the observation that...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Surgical outcomes of the brachial plexus lesions caused by gunshot wounds in adults" pdf
... http://www.jbppni.com/content/4/1/11 Page 5 of 10 (page number not for citation purposes) Pain Management in Brachial Plexus Injuries Injury to the brachial plexus may cause severe pain. Intrac- table pain was assigned in 5 cases ... Brachial plexus injury: a survey of 100 consecutive cases from a single service. Neurosurgery 2002 , 51(3):673-82. 29. Matsuyama T,...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Dominance of highly divergent feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma" pdf
... 9) and with (n = 18) apparent lymphoma. C) Viral (cDNA) FeLV -A/ Glasgow-1 and env variant loads in all tissues. D) Viral (cDNA) env variant loads in tissues with and without apparent lymphoma. ... progeny viruses from t he originally inoculated FeLV -A/ Glas- gow-1foundincat#261maybeexplainedbythelong period (8.5 years) during which the virus had time to evolve in this cat. This, in...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... AGGTGCTTT AAGAATAGTT TTT/AAAAACTATT CTTAAAGCAC CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- TAAGGCAGCACCTACCAAGCCTC,695+ 3A, ... TTGCTGTAC/GTACAGCAAAAAC- TATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAA- TAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Mathematical modeling of the socalled Allis test: a field study in orthopedic confusion" docx
... feet. Asymmetry in distal foot positions resulting from an actual discrepancy in the length of the lower extremities is generally called anatomical leg length inequality (aLLI). Apparent asymmetry ... GA: Anatomic and functional leg-length inequality: A review and recommendation for clinical decision-making. Part I, anatomic leg-length inequality: prevalence, magnitude, effects and clin...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Parents'''' assessment of parent-child interaction interventions – a longitudinal study in 101 families" docx
... 71118 3 years 6101 6 4 years 4101 4 5 years 4711 6 years 167 7 years 246 8 years 156 9 years 213 10 years 415 11 years 033 12 years 202 Child's residence (n = 101 families) Mother & Father ... Interaction;(AVAT) Availability of attachment; (ADAT) Adequacy of attachment; (AVSI) Availability of social integration; (ADSI) Adequacy of social integration. High valu...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx
... ted only in carcino- mas, in 45 cases the transcript was expressed only in carcinomas and not in normal tissue. This may be due to activation of signaling pathways not expressed in normal skin, ... in carcinomas, a table detailing cis- and trans-eQTL counts, a table listing genes altered more than two standard deviations from the mean in carcinomas compared to matched norm...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: " Massive penoscrotal haematoma following inguinal hernia repair: a case report" docx
... a drain in huge inguinal hernia repair and in doubtful haemostasis but we admit that our patient suf- fered from only a moderate sized inguinal hernia. One may argue that if we had used a drain ... not necessarily require ultrasound. In cases of huge scrotal haematoma or unre- solving haematoma, surgical drainage may be necessary. Massive penoscrotal haematoma is not uncommon i...
Ngày tải lên: 11/08/2014, 19:21