Báo cáo y học: "Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis" pptx

Báo cáo y học: "Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis" pptx

Báo cáo y học: "Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis" pptx

... this article as: Doss et al.: Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis. Journal of Cardiothoracic Surgery 2011 ... ventricular hypertrophy. J Am Coll Cardiol 1993, 22:1111-6. 5. Michel PL, Mandagout O, Vahanian A, et al: Ventricular arrhythmias in aortic valve disease befor...

Ngày tải lên: 10/08/2014, 09:22

8 710 0
Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot

Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot

... and AY721605-TURKEY). KWT1 AACAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAGCATCTTGAGTCCCTT 264 KWT2 AA KWT3 AA KWT4 AA KWT5 AA KWT6 AA KWT7 AA KWT8 AA KWT9 AA KWT10 AA KWT11 AA KWT12 AA ... CTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGCTTGTCCT 480 X65259 T X75669 A T-G T KWT-43 CTAATTCCAGGATCTTCAACAACCAGCACGGGACCATGCAGAACCTGCACGACTCCTGCT 540 X65259 X75669 A C T C KWT-...

Ngày tải lên: 12/08/2014, 04:20

5 370 0
Báo cáo y học: "Prognostic factors of 10-year radiographic outcome in early rheumatoid arthritis: a prospective study" ppt

Báo cáo y học: "Prognostic factors of 10-year radiographic outcome in early rheumatoid arthritis: a prospective study" ppt

... G, Barrett E, Silman A, Symmons D: Associations between demographic and disease-related variables and dis- ability over the first five years of inflammatory polyarthritis: a longitudinal analysis ... independent prognostic factors. Results From data available for 112 patients, univariate analysis revealed a total Sharp score at 10 years that was significantly correlated with erythrocyt...

Ngày tải lên: 09/08/2014, 13:21

9 314 0
Báo cáo y học: "Combined ablation of atrial fibrillation and minimally invasive mitral valve surgery: a case report" docx

Báo cáo y học: "Combined ablation of atrial fibrillation and minimally invasive mitral valve surgery: a case report" docx

... CAS E REP O R T Open Access Combined ablation of atrial fibrillation and minimally invasive mitral valve surgery: a case report Hironori Izutani * , Masahiro Ryugo, Fumiaki Shikata, Masashi Kawamura, ... transseptal incision. We describe a new strategy for combined ablation of atrial fibrillation with minimally invasive cardiac surgery by a transseptal approach to the mitral valv...

Ngày tải lên: 10/08/2014, 09:22

4 328 0
Báo cáo y học: " Increased duration of mechanical ventilation is associated with decreased diaphragmatic force: a prospective observational study" doc

Báo cáo y học: " Increased duration of mechanical ventilation is associated with decreased diaphragmatic force: a prospective observational study" doc

... 18.7 Supramaximal stimulation Yes Yes NA No Yes Yes Yes NA No Yes Sepsis Yes Yes Yes Yes Yes Yes Yes Yes Yes No Dialysis Yes No No No No No No No No No CS Yes No Yes Yes Yes Yes Yes 0 Yes Yes AG Yes ... not reached; and in the remaining four of 19, insufficient data are available to evaluate supramaximality. Figure 1 Tracheal, esophageal, and abdominal pressure tracings on bilateral magnet...

Ngày tải lên: 13/08/2014, 21:20

10 232 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... smok- ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy- sis by socioeconomic status. In ... can insure consistency between the initial design and final analysis based on symmetric CIs for estimation using a normal CI ap- proach. Second, a large adequate sample size in each...

Ngày tải lên: 26/10/2012, 09:48

9 533 1
Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"

Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"

... senile cataract patients and normal individuals. Methods and materials: 155 senile cataract patients scheduled for cataract surgery in eye clinic of Rasoul hospital and 155 normal individuals were ... Epidemiological aspects of age related cataract. In: Tasman W, Jaeger A, eds. Duane’s Clinical Ophthalmology. Philadelphia: Lippincott-Raven publishers, 2000:12-14. 9. Kahn HA, et al. T...

Ngày tải lên: 03/11/2012, 09:49

5 611 1
Báo cáo y học: "Diagnostic evaluation of food-related allergic diseases" docx

Báo cáo y học: "Diagnostic evaluation of food-related allergic diseases" docx

... than 2 years of age may have less skin reactivity and thus smaller wheals than older children. Children less than 1 year of age may have IgE-mediated allergic disease related to a particular ... 21 st century, serological measurements of food-specific IgE antibody have become vital to the evaluation of food allergy, especially in children. Serological IgE antibody assays have the...

Ngày tải lên: 08/08/2014, 21:20

7 582 0
Báo cáo y học: " Clinical evaluation of autoantibodies to a novel PM/Scl peptide antigen" doc

Báo cáo y học: " Clinical evaluation of autoantibodies to a novel PM/Scl peptide antigen" doc

... synthesis was purified by high-performance liquid chro- matography. The quality and purity of the peptide was assessed by mass spectrometry and analytical high-perform- ance liquid chromatography. The ... (University of Calgary, Canada) for technical assistance with the addressable laser bead immunoassay and Wilma Vree Egberts (Radboud University Nijmegen, The Netherlands) for technic...

Ngày tải lên: 09/08/2014, 06:22

10 487 0
w