0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis" pptx

Báo cáo y học:

Báo cáo y học: "Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis" pptx

... this article as: Doss et al.: Comparative evaluation of left ventricular mass regression after aortic valve replacement: a prospective randomized analysis. Journal of Cardiothoracic Surgery 2011 ... ventricular hypertrophy. J Am CollCardiol 1993, 22:1111-6.5. Michel PL, Mandagout O, Vahanian A, et al: Ventricular arrhythmias in aortic valve disease before and after aortic valve replacement. ActaCardiol ... rosthesis,mechanical valves).In our study, the pulmonary autografts had signifi-cantly lower transvalvular gradients than the mechanicalvalves. From our understanding of the pathophysiology of aortic valve...
  • 8
  • 710
  • 0
Báo cáo y học:

Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot

... and AY721605-TURKEY).KWT1 AACAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAGCATCTTGAGTCCCTT 264 KWT2 AA KWT3 AA KWT4 AA KWT5 AA KWT6 AA KWT7 AA KWT8 AA KWT9 AA KWT10 AA KWT11 AA KWT12 AA ... CTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGCTTGTCCT 480 X65259 T X75669 A T-G T KWT-43 CTAATTCCAGGATCTTCAACAACCAGCACGGGACCATGCAGAACCTGCACGACTCCTGCT 540 X65259 X75669 A C T C KWT-43 CAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACC ... CAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACC 600 X65259 X75669 C -A T A A A KWT-43 TGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCC 660 X65259 X75669 C C A T-KWT-43 CGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCC...
  • 5
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: "Prognostic factors of 10-year radiographic outcome in early rheumatoid arthritis: a prospective study" ppt

... G, Barrett E, Silman A, Symmons D: Associationsbetween demographic and disease-related variables and dis-ability over the first five years of inflammatory polyarthritis: a longitudinal analysis ... independentprognostic factors.Results From data available for 112 patients, univariate analysisrevealed a total Sharp score at 10 years that was significantlycorrelated with erythrocyte sedimentation rate (ESR), ... HAQ score at five years (r = 0.16; p= 0.007).Table 4Baseline predictive factors of radiographic outcome at 10 years (univariate analysis)Baseline variables Total Sharp score at 10 years Radiographic...
  • 9
  • 313
  • 0
Báo cáo y học:

Báo cáo y học: "Combined ablation of atrial fibrillation and minimally invasive mitral valve surgery: a case report" docx

... CAS E REP O R T Open AccessCombined ablation of atrial fibrillation andminimally invasive mitral valve surgery: a case reportHironori Izutani*, Masahiro Ryugo, Fumiaki Shikata, Masashi Kawamura, ... transseptal incision. We describe a new strategy forcombined ablation of atrial fibrillation with minimally invasive cardiac surgery by a transseptal approach to themitral valve through a partial ... Shikata, Masashi Kawamura, Tatsuhiro Nakata, Toru Okamura,Takumi Yasugi, Mitsugi Nagashima, Kanji KawachiAbstract A partial lower inverted J sternotomy and an extended transseptal incision provide...
  • 4
  • 328
  • 0
Báo cáo y học:

Báo cáo y học: " Increased duration of mechanical ventilation is associated with decreased diaphragmatic force: a prospective observational study" doc

... 18.7Supramaximal stimulation Yes Yes NA No Yes Yes Yes NA No YesSepsis Yes Yes Yes Yes Yes Yes Yes Yes Yes NoDialysis Yes No No No No No No No No NoCS Yes No Yes Yes Yes Yes Yes 0 Yes YesAG Yes ... notreached; and in the remaining four of 19, insufficient dataare available to evaluate supramaximality.Figure 1 Tracheal, esophageal, and abdominal pressure tracings on bilateral magnetic stimulation. ... 2). No data are available for patient 3 inthis table, as analysis revealed only one acceptable tracingfor this patient. The mean between-occasion coefficient of variation was calculated by using...
  • 10
  • 232
  • 0
 Báo cáo y học:

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... smok-ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy-sis by socioeconomic status. In ... can insure consistency between the initial design and final analysis based on symmetric CIs for estimation using a normal CI ap-proach. Second, a large adequate sample size in each compared ... simultaneously, is it accurate and validation? Although most clinical study activities are aimed at showing that equivalence can also be claimed for generic versions of innovator drugs and...
  • 9
  • 532
  • 1
Báo cáo y học:

Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"

... senile cataract patients and normal individuals. Methods and materials: 155 senile cataract patients scheduled for cataract surgery in eye clinic of Rasoul hospital and 155 normal individuals were ... Epidemiological aspects of age related cataract. In: Tasman W, Jaeger A, eds. Duane’s Clinical Ophthalmology. Philadelphia: Lippincott-Raven publishers, 2000:12-14. 9. Kahn HA, et al. The Framingham eye ... Tehran, Iran A Abbssttrr a acctt Many factors such as aging, changes in blood electrolytes levels, and possibly family history are involved in senile cataract formation. Changes...
  • 5
  • 611
  • 1
Báo cáo y học:

Báo cáo y học: "Diagnostic evaluation of food-related allergic diseases" docx

... than 2 years of age mayhave less skin reactivity and thus smaller wheals thanolder children. Children less than 1 year of age may haveIgE-mediated allergic disease related to a particular ... 21stcentury, serological measurements of food-specific IgEantibody have become vital to the evaluation of foodallergy, especially in children. Serological IgE antibodyassays have the advantage of ... estimates of specific IgEantibody in the original serum. The analytical sensitivity of the ISAC varies as a function of the particular allergenspecificity and is generally viewed as less than...
  • 7
  • 581
  • 0
Báo cáo y học:

Báo cáo y học: " Clinical evaluation of autoantibodies to a novel PM/Scl peptide antigen" doc

... synthesis was purified by high-performance liquid chro-matography. The quality and purity of the peptide wasassessed by mass spectrometry and analytical high-perform-ance liquid chromatography. The ... (University of Calgary, Canada) for technical assistance with the addressable laser bead immunoassay and Wilma Vree Egberts (Radboud University Nijmegen, The Netherlands) for technical assistance.References1. ... that thecomplete autoantibody profile is important for a careful exami-nation of patients with rheumatic diseases and to access alltheir clinical features.Frank and colleagues analyzed sera...
  • 10
  • 487
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật