... improve survival? There are few data on the effect of treatment of AF on mortality in ICU patients. A meta-analysis in non-ICU patients showed that class IA, class IC and class III antiarrhythmic agents are equally ... placebo [91,94-97]. A meta-analysis showed that class IA, class IC and class III antiarrhythmic agents are equally effective in obtaining SR [98]. Meta-analy...
Ngày tải lên: 25/10/2012, 10:35
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf
... amplified by two primer pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... distribution of the genetic variants CCR5-Delta 32 and CD45-C77G in a cohort of Italian het- erosexually HIV-1 exposed and uninfected individua...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil occlusion: a report of 3 cases" ppsx
... this article as: Maleux et al.: Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil ... exclude the thoracic aneurysm with use of a stent-graft (Valiant, Medtronic, Santa Clara, CA, USA) after placing a caroti- dosubclavian bypass...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Successful surgical excision of primary right atrial angiosarcoma" docx
... photographs of primary right atrial angiosarcoma . A. Intraoperative photograph; initial view of the right atrial tumor during surgery. B. Macroscopic photograph; broadly resected large tumor of the right ... Contrast angiogram of the right coronary artery (right anterior oblique projection) showing the right coronary artery and two right atrial branches (red arro...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... CAS E REP O R T Open Access Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case ... report Daisuke Yoshioka, Toshiki Takahashi * , Toru Ishizaka and Takuya Higuchi Abstract Cardiac myxoma is the most common primary cardiac tumour, but...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Right coronary artery originating from left anterior descending artery: a case report" pptx
... RCA as a branch of LAD is very rare coronary anomaly. If RCA course is not between aorta and pulmonary artery, this anomaly is accepted as rela- tively benign rare anomaly. In case of classic appearence of ... the left anterior descending artery: a very rare coronary anomaly. Heart Vessels 2002, 16:161-163. 13. Kamran M, oga M: Anomalous right coronary artery orginatin...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Unstable angina early after aortic valve replacement surgery in a female patient with normal coronary arteries preoperatively – a case report" pot
... angina early after aortic valve replacement in patients with normal coronary arteries in the preoperative angiography is rare. Generally, possible differential diagnoses of postoperative angina ... bypass surgery and had an uneventful postoperative recovery. Conclusion Angina pectoris early after aortic valve replacement sur- gery in patients with p...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Clear cell variant of diffuse large B-cell lymphoma: a case report." docx
... CAS E REP O R T Open Access Clear cell variant of diffuse large B -cell lymphoma: a case report Suzana Manxhuka-Kerliu 1* , Gordana Petrusevska 2 , Irma Kerliu 3 , Emrush Kryeziu 4 , Fehmi Ahmeti 6 , Emine ... Devolli-Disha 5 , Vjollca Sahatciu-Meka 6 , Sadushe Loxha 1 and Labinot Shahini 1 Abstract Introduction: Diffuse large B -cell lymphoma is a diffuse proliferat...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Successful medical management of emphysematous gastritis with concomitant portal venous air: a case report" docx
... this article as: Paul et al., Successful medical management of emphyse- matous gastritis with concomitant portal venous air: a case report Journal of Medical Case Reports 2010, 4:140 Paul et al. ... of antibiotic therapy covering anaerobes and gram negative bacilli, intravenous hydration and appropriate nutrition is the mainstay of treatment. Emphysematous...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Atypical clinical presentation of mucopolysaccharidosis type II (Hunter syndrome): a case report" pptx
... presentation of mucopolysaccharidosis type II (Hunter syndrome): a case report Gauri Shankar Shah*, Tania Mahal and Subodh Sharma Abstract Introduction: We present a very rare case of mucopolysaccharidosis ... manifestation of mucopolysaccharidosis type II (Hunter syndrome). Case presentation: A 10-year-old East Asian boy presented with abdominal d...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "Laparoscopic-assisted resection of a giant colonic diverticulum: a case report" ppsx
... in a walled off abscess cavity that gradually enlarges to giant size [7]. Type III contains all layers of bowel wall and structurally resembles a duplica- tion cyst [7] but is in continuity with ... Italian man initially presented to gastroenterologists with a 5-week history of dyspepsia, epigastric pain and a palpable mass in the left hypochron- drium. There was no history of...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Non-surgical management of recurrent perforation of a jejunal diverticulum following previous segmental bowel resection: a case report" ppt
... first case report of recurrent perforation of a jejunal diverticulum to be successfully managed non-operatively. Case presentation: We report a recurrent perforation of a jejunal diverticulum in an ... rate of jejunal diverticula perforation and how perforated jejunal diverticula are best managed. Introduction This is a rare case of repeated perfo...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Successful closed manipulation of a pure lateral traumatic dislocation of the elbow joint using a modified Stimson''''s technique: a case repor" ppt
... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Successful closed manipulation of a pure lateral traumatic dislocation of the elbow ... dislocation of the elbow joint using a modified Stimson's technique: a case report Sameer K Khan*, Rajat Chopra and Debasis Chakrava...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
... the majority of pediatric burn patients was male, had suffered a flame burn injury and had 23% TBSA burn. Inhalation injury was present in 20% of all admitted burns. Respiratory failure Respiratory ... syndrome (ARDS), as defined clini- cally, diffuse alveolar damage (DAD) based solely on findings at autopsy, aspiration or asphyxia, or asthma attack. ARDS was clinically def...
Ngày tải lên: 13/08/2014, 20:21