Báo cáo y học: "Longitudinal evaluation the pulmonary function of the pre and postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol" ppt
Báo cáo y học: "Longitudinal evaluation the pulmonary function of the pre and postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol" ppt
... G, Salica A, Frati G, Sani G: Respiratorydysfunction after coronary artery bypass grafting employing bilateralinternal mammary arteries: the influence of intact pleura. Eur JCardiothorac Surg ... postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol. Journal of Cardiothoracic Surgery 2011 6:62.Moreno et al. Journal of Cardiothoracic Surgery ... vital capacity; MEP = maximal expiratory pressure; MIP =maximal inspiratory pressure; CABG = coronary artery bypass graft; CAD = coronary artery disease; HV = healthy volunteersMoreno et al....
- 6
- 471
- 0
Báo cáo y học: "Self-rated health showed a consistent association with serum HDL-cholesterol in the cross-sectional Oslo Health Study" pptx
... regards adaptation to the Norwegian way of living, in adjusting their traditional dietary habits, and possibly difficulties in correctly interpreting the question about health. Additionally, some ... illnesses only partially explains the association between HDL-C and SRH. Time since food intake The fact that the blood samples were not obtained in the fasting state is a limitation in the present ... hard to appreciate what could be the cause and effect in this association. Obviously, good health is a prerequisite for engaging in physical activity, whilst, on the other hand, physical activity...
- 10
- 347
- 0
Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps
... 5'-CGGTTTGCCAGGAGCTATAGG-3' (forward) and 5'-TCTCGGCCATTTTTCCCATA-3' (reverse); COL1 0A1 , 5'-TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAG-TACAGTGCATAAATAAATAATATATCTCCA-3' ... 5'-GAATGTGATGGGACTGCTTATG-TAGA-3' (forward) and 5'-GCATTTATTTGTACAGGCCCTA-CAA-3' (reverse); SOX6, 5'-CACCAGATATCGACAGAGTGGTCTT-3' (forward) and 5'-CAGGGTTAAAGGCAAAGGGATAA-3' ... 5'-CAGGGTTAAAGGCAAAGGGATAA-3' (reverse); SOX9, 5'-CTTTGGTTTGTGTTCGTGTTTTG-3' (forward) and 5'-AGA-GAAAGAAAAAGGGAAAGGTAAGTTT-3' (reverse); versi-can, 5'-TGCTAAAGGCTGCGAATGG-3'...
- 9
- 307
- 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx
... CTTGTTTACAGTCTGCTCA-AAATATCTTP4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATTReverse 5'-3' AAATCAATTCCCTCATCACTGAAAG,P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAAReverse ... AGCTTCTGTGGAACCATGGAACOL 2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCTReverse 5'-3' GGGCATTTGACTCACACCAGTHIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGTReverse 5'-3' ... 5'-3'TGTTTTACAGCTGGTTAATGTG-TTGASOX9 Forward 5'-3'CTTTGGTTTGTGTTCGTGTTTTGReverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTTCOL 1A2 , collagen type I alpha 2; COL 2A1 , collagen...
- 9
- 356
- 0
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx
... peroxidase-conjugatedTable 1Primers usedMolecule Sense Antisenseβ-actin 5'-AGGCCAACCGTGAAAAGATG-3' 5'-ACCAGAGGCATAC AGGGACAA-3'IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' ... 5'-TCATGAATGCATCCTTTTTTGC-3'IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3'IL-17 5'-GGGAAGTTGGACCACCACAT-3' 5'-TTCTCCACCCGGAAA GTGAA-3'Arthritis ... infiltration and participate in a number of inflammatory and destructive events, such as synovial hyperplasia, pannus for-mation, cartilage and bone erosion, and joint malformation [5-8]. RA was previously...
- 11
- 375
- 0
Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc
... tissue into the synovium may play a role in the initiation and perpetuation of inflammation and degradationprocesses. RAGE as well as AGEs are present in the synoviallining, sublining and endothelium ... BrdU incorporation was measured by a colorimetric assay as a parameter for DNA synthesis. For evaluation of cell viability and metabolic activity the MTT assaywas used. The assay is based on the ... interpretation of data, layout, writing, and final-ization of the manuscript. All authors read and approved the final version of the manuscript.Acknowledgements The authors are thankful to Dr Raimund...
- 19
- 395
- 0
Báo cáo y học: "Minocycline fails to modulate cerebrospinal fluid HIV infection or immune activation in chronic untreated HIV-1 infection: results of a pilot stud" doc
... neopterin. ES designed the flowcytometry assays, directed the SFGH Clinical Immunology Laboratory thatperformed the flow cytometry assays and CSF CCL2 ELISA assays, and analysed and interpreted ... flow cytometry data. RWP designed and oversaw the study, examined study participants, performed lumbar punctures,analysed and interpreted the data, and participated in preparation of the manuscript. ... assisted with the analysis of the data and preparation of the manuscript. SSSexamined study participants, performed lumbar punctures, and assisted in design of the study and reviewed the manuscript....
- 8
- 338
- 0
Báo cáo y học: "Effects on heart pumping function when using foam and gauze for negative pressure wound therapy of sternotomy wounds" pptx
... the caval and lung veins at the back of the thoracic cavity,thereby decreasing the filling pressure in the right and left atria. This may be haemodynamically beneficial, as the load on the heart ... RJ Jr:Multivariate analysis of risk factors for deep and superficial sternalinfection after coronary artery bypass grafting at a tertiary care medicalcenter. Semin Thorac Cardiovasc Surg 2004, ... has remarkableeffects on the healing of poststernotomy mediastinitis, and has reduced the rate of mortality considerably [6]. The organs in the mediastinum are haemodynamicallycrucial, and both...
- 6
- 387
- 0
Báo cáo y học: " Severe refractory autoimmune hemolytic anemia with both warm and cold autoantibodies that responded completely to a single cycle of rituximab: a case report" pps
... acquired hemolytic anemia. The cause of AIHA r emains idiopathic in 50% of the cases [1]. The clinical presentation of AIHA depends on the subclass type: warm agglutinin, cold agglutinin and mixed ... effective in the treat-ment of viral infection-associated nephropathy in con-junction with antiviral therapy. Ohsawa et al. [5] reported the case of a patient with cryoglobulinemia and hepatitisC ... 62-year-old Caucasian m an with a history of chronicalcohol abuse presented to the emergency department with complaints of shortness of b reath and confusion of three days’ duration. The patient’s...
- 5
- 368
- 0
Báo cáo y học: "Ultrasound evaluation of the abductor hallucis muscle: Reliability study" pot
... contributionsAC carried out the literature review, piloting, data collec-tion and drafted the manuscript. KR and WH participated in the design of the study, statistical analysis and drafting of the manuscript. ... that the AbdH muscle and its distal attachment play an impor-tant role in the aetiology as well as in therapy of halluxvalgus [5,29,30]. In orthopaedic, plastic and reconstruc-tive surgery the ... reliability of mus-cle parameters has been in the past difficult. Only with anincrease in accessibility to the higher-end US machines and also the development and increase in availability of low-cost...
- 9
- 361
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngthe waves of globalization asia and financial lobalization in the contextBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)