... improve survival? There are few data on the effect of treatment of AF on mortality in ICU patients. A meta-analysis in non-ICU patients showed that class IA, class IC and class III antiarrhythmic agents are equally ... placebo [91,94-97]. A meta-analysis showed that class IA, class IC and class III antiarrhythmic agents are equally effective in obtaining SR [98]. Meta-analy...
Ngày tải lên: 25/10/2012, 10:35
... Sustained High Quality of Life in a 5-Year Long Term Follow-up after Suc- cessful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort Axel Meissner 1 ... Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Norma...
Ngày tải lên: 03/11/2012, 11:44
Báo cáo khoa học: "Successful surgical correction of anal atresia in a transgenic cloned piglet" doc
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "Successful immunotherapy with matrix metalloproteinasederived peptides in adjuvant arthritis depends on the timing of peptide administration" pdf
... Veenendaal, The Netherlands). The relative MHC binding affinity (IC 50 value) is expressed as the con- centration range of competitor peptide (àM) resulting in 50% inhibition of the MHC binding of the ... usefulness of MMP peptides for immunotherapy. However, a clear understanding of proper timing of peptide administration is crucial for the development of...
Ngày tải lên: 09/08/2014, 03:24
Báo cáo y học: "Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil occlusion: a report of 3 cases" ppsx
... this article as: Maleux et al.: Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil ... exclude the thoracic aneurysm with use of a stent-graft (Valiant, Medtronic, Santa Clara, CA, USA) after placing a caroti- dosubclavian bypass...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Successful surgical excision of primary right atrial angiosarcoma" docx
... photographs of primary right atrial angiosarcoma . A. Intraoperative photograph; initial view of the right atrial tumor during surgery. B. Macroscopic photograph; broadly resected large tumor of the right ... Contrast angiogram of the right coronary artery (right anterior oblique projection) showing the right coronary artery and two right atrial branches (red arro...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... CAS E REP O R T Open Access Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case ... report Daisuke Yoshioka, Toshiki Takahashi * , Toru Ishizaka and Takuya Higuchi Abstract Cardiac myxoma is the most common primary cardiac tumour, but...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... the right ventricle. Comparison of two models of right- left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study. Journal of Cardiothoracic Surgery 2011 6:143. Submit ... regarding the effects of a shunt not at the atrial level but from the pulmonary artery to the left atrium. The purpos...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Successful pregnancy outcome after laparoscopicassisted excision of a bizarre leiomyoma: a case report" pptx
... 5:344 http://www.jmedicalcasereports.com/content/5/1/344 Page 2 of 5 JOURNAL OF MEDICAL CASE REPORTS Successful pregnancy outcome after laparoscopic- assisted excision of a bizarre leiomyoma: a case report Takeda et al. Takeda et al. Journal of ... Int J Gynecol Pathol 2009, 28:529-534. 7. Yamashita Y, Torashima M, Takahashi M, Tanaka N, Katabuchi H, Miyazaki K,...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo y học: "Successful medical management of emphysematous gastritis with concomitant portal venous air: a case report" docx
... this article as: Paul et al., Successful medical management of emphyse- matous gastritis with concomitant portal venous air: a case report Journal of Medical Case Reports 2010, 4:140 Paul et al. ... of antibiotic therapy covering anaerobes and gram negative bacilli, intravenous hydration and appropriate nutrition is the mainstay of treatment. Emphysematous...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Successful treatment of Candida parapsilosis and Pseudomonas aeruginosa infection using medical and surgical management in an injecting drug user with mitral and aortic valve endocarditis: a case report" doc
... and C. parapsilosis endocarditis. Optimal treatment options and cure rate remain to be evaluated. We present a man who had successful treatment with a combination of antibiotics and antifungals ... antifungals in addition to surgical treatment. Conclusion Polymicrobial endocarditis with C. parapsilosis and P. aeruginosa in intravenous drug users can be...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Non-surgical management of recurrent perforation of a jejunal diverticulum following previous segmental bowel resection: a case report" ppt
... first case report of recurrent perforation of a jejunal diverticulum to be successfully managed non-operatively. Case presentation: We report a recurrent perforation of a jejunal diverticulum in an ... rate of jejunal diverticula perforation and how perforated jejunal diverticula are best managed. Introduction This is a rare case of repeated perfo...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Successful closed manipulation of a pure lateral traumatic dislocation of the elbow joint using a modified Stimson''''s technique: a case repor" ppt
... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Successful closed manipulation of a pure lateral traumatic dislocation of the elbow ... dislocation of the elbow joint using a modified Stimson's technique: a case report Sameer K Khan*, Rajat Chopra and Debasis Chakrava...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 NM_004281.3 BCL2 -associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... -2.4 ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transport...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Critical care support of patients with nicotine addiction" docx
... incidence of nicotine withdrawal in critically ill smokers. Critical illness, mechanical ventila- tion, and sepsis can be associated with various levels of encephalopathy. e symptoms and signs of ... impact of confounding factors by matching cases and controls. ere is a scarcity of data addressing the presence and extent of clinically important nicotine withdrawal...
Ngày tải lên: 13/08/2014, 20:21