... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B and family 2 cystatins and also what residues of this loop in cystatin A may participate in the interaction. To ... Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Rev...
Ngày tải lên: 17/03/2014, 10:20
... k cat represents the rate of acylation and K m equals the binding constant of the substrate to the free enzyme. The results then indicate Ó FEBS 2002 Role of active-site phenylalanines in penicillin acylase ... the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of the binding site. To test the effect of the mutations...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc
... 2002 The role of zinc in the methylation of the coenzyme M thiol group in methanol :coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy Markus ... presence of coen- zyme M, indicate how zinc interacts with its substrate coenzyme M and how zinc is most probably coordinated in...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... Taiwan; 3 Department of Pharmacy and Pharmacology, The University of Bath, UK Deacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of penicillin N, the committed step in the biosynthesis ... type of mutant, represented by arginines 306 and 307, are located in the C- terminus. They appear to modulate the activity of the C- t...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx
... purposes) c) The role of probiotics in Allergic Rhinitis Reports on the efficacy of probiotics in treating allergic rhinitis are conflicting. Some studies suggest efficacy such as the study by Wang and ... allergy. factors influencing development of the microbiota. Ann Med 1999, 31(4):288-92. 15. Kalliomaki M, Isolauri E: Role of intestinal flora in the develop- ment...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc
... their role in bone metabolism and repair remains unclear. Review of the evidence To determine the role of COX-2 in bone repair, investiga- tors have studied fracture healing in animal models of COX-2 ... 17:963-976. 11. Einhorn TA. Do inhibitors of cyclooxygenase-2 impair bone healing? J Bone Miner Res 2002, 17:977-978. 12. Zhang X, Schwarz EM, Young DA, Puzas JE,...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
... high and constant level of c-Myc. Also, the contribution of Ras/Raf/ERK prevented the rapid degradation of c-Myc by phosphorylation of the serine 62 residue in the N-terminal of c- Myc [24]. They ... determine if c-Myc transcription inhibitor obstructed the effect of TGF1, and (3) determine the role of ERK1/2 in stabilizing the expression of c-...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt
... evidence for hypoxia in inflammatory and destructive joint disease, and discusses the interplay between alterations in oxygen tension, vascularity and inflammatory signalling pathways. In the present ... for myeloid cell-mediated inflammation and bactericidal capacity of phagocytes, suggesting crosstalk between angiogenesis and inflammation. Review Hypoxia The role...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "The role of osteoprotegerin in arthritis" ppsx
... consequently lead to increasing inter- est in the role of osteoclasts in local bone erosion that is driven by the hypothesis that synovial pannus makes use Review The role of osteoprotegerin in arthritis Georg ... Collagen-induced arthritis Species Rat Mouse Rat Dose 1 mg/kg/day 6.4 mg/kg/day 3 mg/kg/day Start Onset of symptoms Onset of symptoms Onset of symptoms Duratio...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "The role of statins as potential targets for bone formation" pptx
... all bone resorption inhibitors, which act mainly to stabilize bone mass by inhibiting the activity of osteoclasts (the cells responsible for bone loss). The ability of these drugs to increase bone ... an Commentary The role of statins as potential targets for bone formation I Ross Garrett 1 and Greg R Mundy 2 1 OsteoScreen, San Antonio, Texas, USA 2 The Institute...
Ngày tải lên: 09/08/2014, 03:24
Báo cáo y học: "The role of structural genes in the pathogenesis of osteoarthritic disorder" potx
... and in the pathogenesis of OA. Keywords: cartilage, chromosomes, genetics, linkage, osteoarthritis Review The role of structural genes in the pathogenesis of osteoarthritic disorders Anthony M ... the genes encoding these structural components of the matrix have provided insight into the function of the individual gene products in the pathogene...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx
... Access The role of traditional healers in tooth extractions in Lekie Division, Cameroon Ashu M Agbor 1* , Sudeshni Naidoo 1 and Awono M Mbia 2 Abstract Background: The extraction of the teeth by traditional ... skele- tons of Early Iron Age populations (ca. 1500 years before present)[3]. Traditional healers in Africa have been carry ing out surge ry ranging fro...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot
... Central Page 1 of 7 (page number not for citation purposes) Journal of Inflammation Open Access Research The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles Susan ... viability in all types of muscle. Conclusion: These results show that in skeletal muscle, IR injury is dependent upon both the presence of...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx
... mortality caused by WSSV. The results suggested that F 1 -ATP synthase beta subunit plays a role in the WSSV infection. Conclusions F 1 F 0 -ATP synthase complexes play a central role in the synthesis ... F 1 ATP synthase beta subunit nucleotide-binding domain, ATP synthase alpha/ beta chain N terminal domain, ATP synthase alpha /beta chain C...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
... that p 21/ waf1 and cyclin D2 are complexed together in HTLV -1 infected cells. Cell cycle analysis of cyclin D2 and p 21/ waf1 p 21/ waf1 has been previously described as an assembly factor for cyclin ... cdk4, cyclin E, p 21/ waf1 wildtype (WT), p 21/ waf1 mutant in the cyclin binding site (mut), p16/INK4A, and cyclin D2 were expressed and purifie...
Ngày tải lên: 13/08/2014, 13:20