... 11 RESEARC H Open Access Use and knowledge of the razor-billed curassow Pauxi tuberosa (spix, 1825) (galliformes, cracidae) by a riverine community of the Oriental Amazonia, Brazil Flávio B Barros 1,2* , ... razor-billed curassow Pauxi tuberosa (spix, 1825) (galliformes, cracidae) by a riverine community of the Ori...
Ngày tải lên: 10/08/2014, 09:21
... the participating ACTG sites and especially the study participants. This study was supported in part by the AIDS Clinical Trials Group funded by the National Institute of Allergy and Infectious Diseases (AI ... IL-2 in patients treated with antiretroviral therapy (ACTG Protocol A5 051, a rollover trial of ACTG Protocol A3 28). AIDS Research and Therapy 2010 7:30. Bos...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " New and old complex recombinant HIV-1 strains among patients with primary infection in 1996–2006 in France: The French ANRS CO06 primo cohort study" potx
... with 04FR- AUK/MAL/NOGIL and which displayed the same recom- binant structure in that part of the genome as shown by additional bootscan and simplot analysis. Some of these strains had also been ... sequencing and the phylogenetic analysis of the strains. CG, LM and CD carried out the coordination of the ANRS PRIMO cohort and have been involved in revising the...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"
... pharmacist consultations in primary care. Fam Pract 2000, 17(6):480-3. 4. Hassell K, Rogers A, Noyce P: Community pharmacy as a primary health and self-care resource: a framework for understanding pharmacy utilization. ... the interpretations of data and on the manuscript. SMG and EKY supervised the whole research process. All authors read and approved the final manus...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"
... for overall health in primary care. There are a number of studies that have evaluated the effectiveness of chiropractic care on patient’s health and general health status as measured by the Short-Form 36 ... further overall statistical analysis of data and drafted the manuscript. All authors read and approved the final manuscript. Competing interests The authors decl...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Risk and Benefit of Drug Use During Pregnancy"
... Roaccutan Cardiac CAs Etretinate Tigason X 25 Small ear 0 0 Neotigason Adactyly Cardiac CAs Coumarin derivative Warfarin, Dicumarol, Syncumar D 25 Nasal hypoplasia-depressed nasal bridge ... when asked about the history of their pregnancy, give a long list of supposed agents. On the other hand the mothers of healthy babies are thinking of the present and future...
Ngày tải lên: 02/11/2012, 11:12
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
... becomes more accessible for the transcriptional machinery. However, Southern analysis and b-Gal assays revealed that the efficiencies of recombination by Cre and gd102NLS remain unaffected by these inhibitors. ... organization. Our analysis employing inhibitors of histone deacetylase and topoisomerases revealed that the reactivity of res remained unaffected, even though...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: Engineering and use of 32P-labeled human recombinant interleukin-11 for receptor binding studies docx
... (5¢- GGAATTCCATATGGACTACAAGGATGACGATG ACAAG-3¢) and G354 (5¢-ATAGTTTAGCGGCCGCT CACAGCCGAGTCTTCAG-3¢) and the above plasmid as template. The expression plasmid pET-FCPDIL1 1 was constructed b y insertion ... tag (Asp-Tyr-Lys- Asp-Asp-Asp-Asp-Lys) followed by a consensus amino- acid sequence (Arg-Arg-Ala-Ser-Val-Ala) that can be recognized and phosphorylated on the serine resi...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo y học: "Trends and determinants of Comprehensive HIV and AIDS knowledge among urban young women in Kenya" docx
... Lutfor: Media and education play a tremendous role in mounting AIDS awareness among married couples in Bangladesh. AIDS Research and Therapy 2007, 4. Ochako et al. AIDS Research and Therapy 2011, ... multivari- ate analysis was therefore based on the latest available data, KDHS 2008/2009, to provide a clear indication on the most recent determinants of HIV and AIDS Ochako et...
Ngày tải lên: 10/08/2014, 05:22
Báo cáo y học: "Traditional-Medical Knowledge and Perception of Pangolins (Manis sps) among the Awori People, Southwestern Nigeri" ppsx
... Complementary and Alternative Medicine 2009, 9:1-18. 20. Mahawar MM, Jaroli DP: Traditional knowledge on zootherapeutic uses by the Saharia tribe of Rajasthan, India. Journal of Ethnobiology and Ethnomedicine ... urban mar- kets in many African towns and cities [17]. Several authors have also recorded a wide variety of animals and their parts in sales for other parts of...
Ngày tải lên: 10/08/2014, 09:22