Báo cáo y học: "In search of traditional bio-ecological knowledge useful for fisheries co-management: the case of jaraquis Semaprochilodus spp. (Characiforme" ppsx

Báo cáo y học: "In vitro bactericidal activities of Japanese rice-fluid against Helicobacter pylori strains"

... regimens against H. pylori infections. The mechanism of their bactericidal activities against H. pylori strains remains to be elucidated. Key words: Helicobacter pylori, bactericidal activity, antibacterial ... 3(3):112-116 â2006 Ivyspring International Publisher. All rights reserved Research Paper In vitro bactericidal activities of Japanese rice-fluid against Helicobacter pylori strains Yoshiyuki Kawakami1, ... Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet , 1993 342: 575-577. 11. European Helicobacter Pylori...

Báo cáo y học: "TPO, but not soluble-IL-6 receptor, levels increase after anagrelide treatment of thrombocythemia in chronic myeloproliferative disorders"

... supported by the recent findings of McCarty et al, who showed an effect of anagrelide on CD41 numbers and TPO-specific pTyr activity in vitro, indicating that anagrelide reduces the TPO-mediated intracellular ... Lacey D, Hill D, Chen Y, Fletcher F, Hawley RG, McNiece IK A model of myelofibrosis and osteosclerosis in mice induced by overexpressing thrombopoietin (mpl ligand): reversal of disease by bone ... Giraudier S, Vainchenker W, Wendling F. Prominent role of TGF-beta 1 in thrombopoi-etin-induced myelofibrosis in mice. Blood 2002;100:3495-503 32. Erusalimsky JD, Franklin R and Hong Y. Is the...

Tài liệu Báo cáo Y học: Systematic search for zinc-binding proteins in Escherichia coli potx

... N-terminal sequencing. In addition to ﬁve known zinc-binding proteins, nine zinc-binding proteins were newly identiﬁed including: acetatekinase (AckA), DnaK, serine hydroxymethyltransferase(GlyA), ... speciﬁcity and aﬃnity of zinc-binding wereanalysed for some of the zinc-binding proteins. Keywords: zinc-binding protein; Escherichia coli; proteome;two-dimensional gel electrophoresis.Zinc is ... hormone receptor-type zinc-binding motif. This type of zinc-binding proteins appears in Caenorhabditis elegans [5] and the number of this type of zinc-binding proteins increases in higher animals.The...

Báo cáo Y học: In vivo activation of plasma membrane H+-ATPase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis docx

... Biochem. 269) 1007 In vivo activation of plasma membrane H+-ATPase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis Agustı´n Herna´ndez1, David T. ... that polypeptide amounts of Fig. 3. Eﬀe cts of vanadate and erythrosin B on the substrate dependence of H+-ATPase hydrolytic activity from U. maydis plasma membrane vesicles. Models of inhibition. ... in th is stud y [18,21].This regulation by CLB -unsaturated fatty acids in U. maydis d iffers from other s described. For example,glucose-induced activation of plasma membrane H+-ATPase in...

Báo cáo Y học: Cytochrome c from a thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability potx

... thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability Yoshihiro Sambongi1, Susumu Uchiyama2,*, Yuji Kobayashi2, Yasuo Igarashi3 and Jun Hasegawa41Graduate ... and areapplicable to the elucidation of the dynamic features of cytochromes c. It is of interest to characterize cytochrome c with respect to protein maturation, folding, stability, and function ... Although the cytoplasmic holo-(TT c- 552) has the same function and spectra as the authentic one, the cytoplasmic soluble protein fraction also contains a minorproduct, which has a heme attached...

Báo cáo toán học: "Colouring 4-cycle systems with speciﬁed block colour patterns: the case of embedding P3-designs" ppsx

... that the existence of a 4-cycle system of order n having an m-colouring of type bd, implies the one of a 4-cycle system of order n + 8 having an (m + 1)-colouring of type bd. ✷4 2-Colouring of ... ,n+34} thereis a 4-cycle system of order n with a proper m-colouring of type bf .Proof.Thecasesm =3andm =n+34are proved by using Theorem 2.3 and Theorem2.4 respectively.Starting from the 3-coloured ... which only speciﬁed block colouring patterns areallowed. In this paper we want to consider strict colouring in the sense of Voloshin of 4-cycle systems in which only speciﬁed block colouring...

Báo cáo y học: "Is Obesity Associated with an Increased Risk for Airway Hyperresponsiveness and Development of Asthma" pdf

... interval.Sharma et al, Association between Obesity and Asthma 53 ORIGINAL ARTICLEIs Obesity Associated with an Increased Risk for Airway Hyperresponsiveness and Development of Asthma?Sat Sharma, MD, FRCPC, ... all levels of obesity. Class I obesity had an OR of 1.47 (95% CI 1.04–2.08) and an AR of 22%, whereas a higher risk was observed with obesity classes II and III, in which the ORs and ARs were1.72 ... increased airways resistance and methacholine reactivity. Therefore, obese patientscomplain of more dyspnea and asthma-like symptomsthan leaner patients and may be incorrectly diagnosed with asthma.28,29In...

Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt

... of the proinflammatory cytokines IL-1 β , tumor necrosis factor alpha and IL-17 in rheumatoid synoviocytesCorinne Granet1, Wova Maslinski2 and Pierre Miossec11Department of Immunology ... contribution of IL- 1β, tumor necrosis factor alpha (TNF-α) and IL-17 to AP-1, NF-κB and Egr-1 activation in rheumatoid arthritis, the effect of the cytokines used alone or in combination was measured ... IL-1 inhibitors strongly support the importance of cytokines in RA. These cytokines arekey activators of the TFs AP-1, Egr-1 and NF-κB. Bindingsites for these TFs have been identified in the...

Báo cáo y học: "THR0921, a novel peroxisome proliferator-activated receptor gamma agonist, reduces the severity of collagen-induced arthritis" pps

... forward 5'-GCCTCTTCT-CATTCCTGCTT-3', reverse 5'-CACTTGGTGGTTT-GCTACGA-3'; for IL-1β, forward 5'-CCCAAGCAATACCCAAAGAA-3', reverse 5'-CATCAGAG-GCAAGGAGGAAA-3'; ... indicating that PPARγ agonists can inhibit activa-tion of monocyte/macrophages [34]. As macrophages initiate the inflammatory process and are the source of manycytokines responsible for cartilage and ... weeks. The clinical disease activity of CIA was determined every other day using a three-point scale for each paw. Data are expressed as mean ± standard error of the mean (n = 10/group; asterisks...

Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx

... neurotoxin.Review High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic diseaseDavid S Pisetsky 1, 2, Helena Erlandsson-Harris3and Ulf Andersson4 1 Division of Rheumatology ... mediated by HMGB1 and RAGE. Nat Immunol 2007, 8:487-496.59. Jiang W, Pisetsky DS: Expression of high mobility group protein 1 in the sera of patients and mice with systemic lupuserythematosus. Ann ... activity of HMGB1 inacute and chronic inflammatory conditions, including the rheumatic diseases. Since HMGB1 may be a target of newtherapy, HMGB1 biology has emerged as a rapidly expandingfield of...

Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps

... AC:adenylate cyclase; ADM: adrenomedullin; ADMR: adrenomedullin receptor; GC: guanylate cyclase; Gs: stimulatory GTP-binding protein; nNOS: neuronal nitric oxide synthase; PKA: protein kinase ... Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats. Journal of Biomedical Science 2011 18:32.Submit your next manuscript ... microinjection of the test agent into NTS. The BRR response was represented by the ratio of the peak magnitude of reflex bradycardia to the peak magni-tude of phenylephrine-induced pressor response. ...

Báo cáo y học: "In search of traditional bio-ecological knowledge useful for fisheries co-management: the case of jaraquis Semaprochilodus spp. (Characiforme" ppsx

... pro-portions with the null hypothesis where the informationwas the same [21]. The assumption of normality was eval-uated by the Kolmogorov-Smirnov test and of the homo-cedasticity by the Bartlett ... article as: Batista and Lima, In search of traditional bio-ecological knowledge useful for fisheries co-management: the case of jaraquis Semap-rochilodus spp. (Characiformes, Prochilodontidae) in ... exploitationobserved for the jaraquis in research in the area [8,10]and the former to the findings of Bayley [53]. However, the fishermen's findings were very superficial and with-out details particularly...

Báo cáo y học: " Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture technique" pot

... CAS E REP O R T Open Access Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture techniqueMarco Agrifoglio*, Sara Filippini, ... The surgicalfindings confirmed a partial prosthesis detachment at the level of the non coronary aortic sinus, due to the semicontinuous suture breaking (Figure 2). The othertwo sutures of the ... endocarditis, but it may also occurswithout definite signs of infection. We report a case of redo aortic prosthesis replacement after 7 years from the operation and we discuss the role of suture techni-que...

Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx

... Access b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryosYi-Ting Wu1, Che Yi Lin1, Ming-Yuan Tsai2, ... cell death of erythrocytes and the endocardium in zebrafish embryos by b-lapachone ismediated through an NQO1- and calcium-dependentpathway The linear arrangement of the ventricle and atrium and the ... erythrocyte-deficiency in circulation and heart- looping defect phenotypes in b-lapachone- treated embryos. These resultssuggest that the induction of apoptosis of endocardium and erythrocytes by b-lapachone...

Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf

... 9:1484-1490.doi:10.1186/1743-422X-8-17Cite this article as: Fan et al.: Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation. ... onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammationYang Fan, Wu Weifeng1,2*, Yan Yuluan, Kong Qing, Pang Yu, Huang YanlanAbstractBackground: Recently, some ... sense:5’CACAGAAGGAGTGGCTAAGGACCA3’antisense:5’ACGCACTAGGTTTGCCGAGTAGA3’103 bpIL-17[GenBank:16171] sense: 5’GTCAATGCGGAGGGAAAG3’antisense: 5’CACGAAGCAGTTTGGGAC 3’349 bpTNF -a GenBank:21926]sense:...

Xem thêm