Báo cáo y học: "CLOCK is suggested to associate with comorbid alcohol use and depressive disorders" ppt

Báo cáo y học: "Line bisection performance in patients with generalized anxiety disorder and treatment-resistant depressionLine bisection performance in patients with generalized anxiety disorder and treatment-resistant depression"

Báo cáo y học: "Line bisection performance in patients with generalized anxiety disorder and treatment-resistant depressionLine bisection performance in patients with generalized anxiety disorder and treatment-resistant depression"

... predominance and risk-taking in healthy university students has also proven by studying the line bisecting performance and Zucker- man’s sensation seeking scales in Drake and Ulrich’s study 36 . ... 2010; 7(4):224-231 â Ivyspring International Publisher. All rights reserved Research Paper Line bisection performance in patients with generalized anxiety disorde...

Ngày tải lên: 26/10/2012, 08:57

8 573 0
Báo cáo Y học: The amyloid precursor protein interacts with neutral lipids Liposomes and monolayer studies pdf

Báo cáo Y học: The amyloid precursor protein interacts with neutral lipids Liposomes and monolayer studies pdf

... Therefore, alteration of the charge of the protein could be induced at the vicinity of the monolayer. A difference in the orientation of the protein moiety during the insertion process into the ... the protein were probably affected by electro- static interactions with the lipid layers. Our results indicate that the penetration of the protein into the lipid...

Ngày tải lên: 31/03/2014, 21:21

9 436 0
Báo cáo y học: "Giantin is the major Golgi autoantigen in human anti-Golgi complex sera" pptx

Báo cáo y học: "Giantin is the major Golgi autoantigen in human anti-Golgi complex sera" pptx

... from the Golgi membrane into the cytoplasm. Our working hypothesis is that aberrantly expressed Golgi complex autoantigens may be released into the immune system when cells undergo lysis. By virtue ... prominent function in the processing, transport- ing, and sorting of intracellular proteins subsequent to their synthesis in the rough endoplasmic reticulum. Struc- turall...

Ngày tải lên: 09/08/2014, 01:23

8 342 0
Báo cáo y học: "Remission by composite scores in rheumatoid arthritis: are ankles and feet important" pptx

Báo cáo y học: "Remission by composite scores in rheumatoid arthritis: are ankles and feet important" pptx

... assessment in RA. In this study, we showed that the assessment of joint activity in the feet, beyond assessment of joint activity by the 28-joint count, does not convey significant added value in the ... that while providing useful and important clinical information, the inclusion of ankles and feet only rarely influences the definition of overall disease activity status, e...

Ngày tải lên: 09/08/2014, 10:20

9 343 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCA...

Ngày tải lên: 09/08/2014, 23:20

36 447 0
Báo cáo y học: "CLOCK is suggested to associate with comorbid alcohol use and depressive disorders" ppt

Báo cáo y học: "CLOCK is suggested to associate with comorbid alcohol use and depressive disorders" ppt

... R: Primary anxiety disorders and the development of subsequent alcohol use disorders: a 4-year community study of adolescents and young adults. Psychol Med 2003, 33:1211-1222. 52. Sher L: Alcoholism and ... 95:195-200. doi:10.1186/1740-3391-8-1 Cite this article as: Sjöholm et al.: CLOCK is suggested to associate with comorbid alcohol use and depressive disorders...

Ngày tải lên: 10/08/2014, 09:20

9 419 0
Báo cáo y học: "Aortitis requiring aortic repair associated with glaucoma, thyroiditis, glaucoma, and neuropathy: case" docx

Báo cáo y học: "Aortitis requiring aortic repair associated with glaucoma, thyroiditis, glaucoma, and neuropathy: case" docx

... Stöllberger et al.: Aortitis requiring aortic repair associated with glauc oma, thyroiditis, glaucoma, and neuropathy: case report. Journal of Cardiothoracic Surgery 2011 6:74. Submit your next manuscript ... giant cell arteritis, spondylarthropathy, Behcet’s syndrome, relapsing poly- chondritis, Cogan’s syndrome, retroperitoneal fibrosis, ankylosing spondylitis, systemic lu...

Ngày tải lên: 10/08/2014, 09:21

4 353 0
Báo cáo y học: "Papillary fibroelastoma of the aortic valve - a case report and literature review" pptx

Báo cáo y học: "Papillary fibroelastoma of the aortic valve - a case report and literature review" pptx

... papillary fibroelastoma of the aortic valve in a young woman -a case report. Cardiovascular Ultrasound 2009, 7:43. 9. Sato Y, Yokoyama H, Satokawa H, Takase S, Maruyama Y: A report of a surgical case ... two cases and review of the literature. Annals of Clinical & Laboratory Science 2001, 31(3):29 1-2 96. 8. Parthenakis F, Nyktari E, Patrianakos A,...

Ngày tải lên: 10/08/2014, 09:22

5 631 0
Báo cáo y học: " Beta-2-transferrin to detect cerebrospinal fluid pleural effusion: a case report" pptx

Báo cáo y học: " Beta-2-transferrin to detect cerebrospinal fluid pleural effusion: a case report" pptx

... effusion and a shunt series demonstrated an appropriately placed distal catheter tip. A subsequent abdominal ultrasound revealed marked ascites. Fluid drained via tube thoracostomy was sent for beta-2-transferrin ... Firstly, they propose that an error in surgical shunt placement, with resultant intrathoracic trauma, may account for some cases of CSF hydrothorax. Secondly, Taub and La...

Ngày tải lên: 11/08/2014, 17:21

5 374 0
Báo cáo y học: " Pulmonary fibrosis secondary to siderosis causing symptomatic respiratory disease: a case report" pptx

Báo cáo y học: " Pulmonary fibrosis secondary to siderosis causing symptomatic respiratory disease: a case report" pptx

... with symptomatic respiratory disease, most likely secondary to associated fibrosis. Case presentation: A 66-year-old Caucasian man was referred to the outpatient clinic with a 2- year history of ... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Pulmonary fibrosis secondary to siderosis causin...

Ngày tải lên: 11/08/2014, 21:22

3 426 0
Báo cáo y học: "In vivo approaches to investigate ANCA-associated vasculitis: lessons and limitations" pps

Báo cáo y học: "In vivo approaches to investigate ANCA-associated vasculitis: lessons and limitations" pps

... proinfl ammatory properties promoting neutrophil and monocyte recruit ment and stimulation of release of proinfl ammatory cytokines such as TNF and IL-1 by macrophages. Interestingly, increased ... In vivo approaches to investigate ANCA-associated vasculitis: lessons and limitations. Arthritis Research & Therapy 2011, 13:204. Heeringa and Little Arthritis Researc...

Ngày tải lên: 12/08/2014, 15:22

10 243 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

... Central Page 1 of 5 (page number not for citation purposes) Clinical and Molecular Allergy Open Access Research Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in ... that recent and recurrent episodes of acute chest syndrome are risk factors for cerebral vascular accidents [10]. Our findings of increased cerebr...

Ngày tải lên: 13/08/2014, 13:22

5 288 0
Báo cáo y học: " Bringing metabolic networks to life: integration of kinetic, metabolic, and proteomic data" pptx

Báo cáo y học: " Bringing metabolic networks to life: integration of kinetic, metabolic, and proteomic data" pptx

... 1 of 11 (page number not for citation purposes) Theoretical Biology and Medical Modelling Open Access Research Bringing metabolic networks to life: integration of kinetic, metabolic, and proteomic ... kinetic, thermodynamic, metabolic, and proteomic data. The structure of the metabolic system (i.e., stoichiometries and enzyme regulation) needs to be...

Ngày tải lên: 13/08/2014, 16:21

11 418 0
Báo cáo y học: "Where is the difference between the genomes of humans and annelids" pot

Báo cáo y học: "Where is the difference between the genomes of humans and annelids" pot

... without any valuable role for the organism [14]. Therefore, organis- mal complexity cannot be simply determined by the genome size, the number of protein-coding genes, the number of introns, or the ... from dozens of eukaryotic and hundreds of prokaryotic species. This has only brought us to the embryonic stage of genome biology theory and numerous surprises are to b...

Ngày tải lên: 14/08/2014, 16:20

2 384 0
w