Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"

Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"

... Discussion and Conclusions To address the question whether the +T294C polymorphism in PPAR is associated with the risk for coronary heart disease and/ or plasma lipid levels in women, we investigated ... state the activities of numerous interacting genes are altered which may influence the effect of PPAR on metabolism. In our data and in the stu...

Ngày tải lên: 31/10/2012, 17:03

4 568 0
Báo cáo y học: "Vitamin D receptor gene BsmI polymorphisms in Thai patients with systemic lupus erythematosus" potx

Báo cáo y học: "Vitamin D receptor gene BsmI polymorphisms in Thai patients with systemic lupus erythematosus" potx

... has been demonstrated that patients with SLE have a lower level of 25 hydroxyvitamin D3 than do healthy controls [3]. In addition, high-dose 1,25-dihydroxyvitamin D3 and its analog may be useful ... pancreas, bone, skin, gonads, and activated T and B lymphocytes, have the nuclear receptor for 1,25-dihydroxyvitamin D3 (VDR). Thus, it is not surprising that 1,25-dihydroxyvitamin D3...

Ngày tải lên: 09/08/2014, 07:20

4 331 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... based on the method by Cawthon et al[33]. Briefly, commercially obtained telo- mere specific primers; CGGTTTGT TTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT ... 2008, 129:60-66. doi:10.1186/1423-0127-18-41 Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seaso...

Ngày tải lên: 10/08/2014, 05:21

11 527 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

... immune status during ART. Background CD8+ T cells play an important role in protection against intracellular pathogens. Eliminating CD8+ T lymphocytes from monkeys during chronic SIV infection resulted ... changes of CD8+ T cell subsets during initial ART are complex. Our results display a complete phenotypical picture of CD8+ cell subsets during ini...

Ngày tải lên: 10/08/2014, 05:22

7 338 0
Báo cáo y học: "Prevalence of Dysglycemia Among Coronary Artery Bypass Surgery Patients with No Previous Diabetic History" ppsx

Báo cáo y học: "Prevalence of Dysglycemia Among Coronary Artery Bypass Surgery Patients with No Previous Diabetic History" ppsx

... McGinn et al.: Prevalence of Dysglycemia Among Coronary Artery Bypass Surgery Patients with No Previous Diabetic History. Journal of Cardiothoracic Surgery 2011 6:104. Submit your next manuscript ... very common association of dysglycemia with coronary artery disease, since whe n including the previously and newly diagnosed patients, a total of 80% of...

Ngày tải lên: 10/08/2014, 09:22

6 387 0
Báo cáo y học: "Prevalence of accessory deep peroneal nerve in referred patients to an electrodiagnostic medicine clinic" pdf

Báo cáo y học: "Prevalence of accessory deep peroneal nerve in referred patients to an electrodiagnostic medicine clinic" pdf

... Access Prevalence of accessory deep peroneal nerve in referred patients to an electrodiagnostic medicine clinic Seyed Mansoor Rayegani 1* , Elham Daneshtalab 2 , Mohamad Hasan Bahrami 1 , Dariush ... relative of healthy control group, reflecting autosomal dominant transmission [6]. Studies show that, the inheritance pattern of the accessory deep peroneal ner...

Ngày tải lên: 10/08/2014, 10:20

5 320 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx

Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx

... of symptoms. Discussion Femoral shaft fracture is usually caused by a high energy trauma. In this case it is possible that trauma energy was rotational and totally absorbed by the femoral shaft due ... this article as: Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report. Journal of Medic...

Ngày tải lên: 11/08/2014, 03:20

4 355 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt

Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt

... usually caused by a high energy trauma. In this case it is possible that trauma energy was rotational and totally absorbed by the femoral shaft due to the lack of motion at the dysplastic hip, ... this article as: Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report. Journal of Medical Case...

Ngày tải lên: 11/08/2014, 06:23

4 289 0
Báo cáo y học: "Suppression of LPS-induced inflammatory responses in macrophages infected with Leishmania" pot

Báo cáo y học: "Suppression of LPS-induced inflammatory responses in macrophages infected with Leishmania" pot

... certain proinflammatory cytokine responses in a parasite-specific manner, however it augments the production of other proinflammatory cytokines. Our findings highlight the complexity of inflammatory ... counter -inflammatory response against LPS-induced proinflammatory macrophage cytokines, we also analysed the effect of Leishmania uptake upon LPS-induction of the proinflamma...

Ngày tải lên: 11/08/2014, 08:22

9 210 0
Báo cáo y học: " Expression of Toll-like Receptor 9 in nose, peripheral blood and bone marrow during symptomatic allergic rhinitis" ppsx

Báo cáo y học: " Expression of Toll-like Receptor 9 in nose, peripheral blood and bone marrow during symptomatic allergic rhinitis" ppsx

... during the same period. Flow cytometry analysis of TLR9 leukocyte expression was performed on samples obtained during symptomatic allergic rhinitis. Samples of bone marrow, peripheral blood and ... leukocytes during allergic rhinitisFigure 5 Expression of TLR9 in leukocytes during allergic rhinitis. Intracellular expression of TLR9, presented as MFIR,...

Ngày tải lên: 12/08/2014, 15:20

13 249 0
Báo cáo y học: " Pharmacokinetics of recombinant activated factor VII in trauma patients with severe bleeding" pdf

Báo cáo y học: " Pharmacokinetics of recombinant activated factor VII in trauma patients with severe bleeding" pdf

... Santagostino E, Morfini M, Rocino A, Baudo F, Scaraggi FA, Gringeri A: Relationship between factor VII activity and clinical efficacy of recombinant factor VIIa given by continuous infu- sion in patients ... properly cited. Abstract Introduction Recombinant activated factor VII (rFVIIa) has been used as adjunctive therapy in trauma patients with severe bleeding...

Ngày tải lên: 13/08/2014, 01:20

10 348 0
Báo cáo y học: " Discovery of adult T-cell leukemia" doc

Báo cáo y học: " Discovery of adult T-cell leukemia" doc

... Drs. Kazunari Yamaguchi, Toshio Hat- tori, and Masao Matsuoka, who are now independently working in Tokyo, Sendai and Kyoto, respectively. Development of virology This discovery of ATL ushered ... in Japan. We can mention many examples in the field of hematology. One of these is that the incidence of chronic lymphocytic leukemia is quite low, being only 2% of all hematological m...

Ngày tải lên: 13/08/2014, 09:21

3 269 0
Báo cáo y học: " Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms" pps

Báo cáo y học: " Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms" pps

... Tamiya S, Koga S, Mita S, Uch- ino M, Mitsuya H, Matsuoka M: Impaired production of naive T lymphocytes in human T-cell leukemia virus type I- infected individuals: its implications in the immunodeficient ... 1 of 16 (page number not for citation purposes) Retrovirology Open Access Research Silencing of human T-cell leukemia virus type I gene transcription...

Ngày tải lên: 13/08/2014, 09:21

16 254 0
Báo cáo y học: " Infections of respiratory or abdominal origin in ICU patients: what are the differences" docx

Báo cáo y học: " Infections of respiratory or abdominal origin in ICU patients: what are the differences" docx

... defined as infections occurring more than 24 hours after onset of a preexisting infection, at a site other than the abdominal or respiratory system for patients in the abdominal or respiratory ... with abdominal infections than in those with respiratory infections. Secondary infections were more common in patients with abdominal infections (70patients,4...

Ngày tải lên: 13/08/2014, 20:21

10 349 0
Từ khóa:
w