Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx

Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx

Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx

... this article as: Sprague et al.: Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry. AIDS Research and Therapy 2011 8:10. Submit your ... Research and Therapy 2011, 8:10 http://www.aidsrestherapy.com/content/8/1/10 Page 3 of 9 RESEARCH Open Access Health system weaknesses constrain acce...

Ngày tải lên: 10/08/2014, 05:22

9 404 0
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

... CAAACTCTTTTGCTTGGGCT R CACTGGACAACTCGCAGATG AF125041 Biglycan 65 204 F CCATGCTGAACGATGAGGAA R CATTATTCTGCAGGTCCAGC AF034842 Fibromodulin 65 442 F CTGGACCACAACAACCTGAC R GGATCTTCTGCAGCTGGTTG AF020291 Lumican ... CCTCCAGGTCAGCTTCGCAA NM174030 Collagen I 65 460 F CCACCAGTCACCTGCGTACA R GGAGACCACGAGGACCAGAA AF129287 Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTG R GTGGGGAAACTGCACAACAT L47641 GAPDH 55...

Ngày tải lên: 09/08/2014, 06:23

10 416 0
Báo cáo Y học: Identification of residues critical for activity of the wound-induced leucine aminopeptidase (LAP-A) of tomato pptx

Báo cáo Y học: Identification of residues critical for activity of the wound-induced leucine aminopeptidase (LAP-A) of tomato pptx

... C a of Glu and its carboxylate oxygen, C a of Asp a nd its carboxylate oxygen, C a of Arg and its side-chain amines or guanidinium, and C a of Lys and its side-chain amine was determined by measuring ... metallopeptidases that have high temperature and pH optima and are inhibited by the potent amino- peptidase inhibitors amastatin and bestatin [3,4]. Analysis of amino...

Ngày tải lên: 08/03/2014, 23:20

11 423 0
Báo cáo hóa học: " Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" ppt

Báo cáo hóa học: " Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" ppt

... enucleation and EBRT, d) different combina- tions of chemotherapy and remaining therapies (thermo- chemotherapy, laser photocoagulation, plaque therapy and cryotherapy)[5]. Visual acuity was defined ... gender, age group (8–11 years or 12–18 years), marital status of par- ents, heredity, type of treatment, and visual acuity. Prelim- inary analyses showed interdependency of all illness...

Ngày tải lên: 18/06/2014, 22:20

8 385 0
báo cáo hóa học:" Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" doc

báo cáo hóa học:" Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" doc

... chemotherapy and remaining therapies (thermo- chemotherapy, laser photocoagulation, plaque therapy and cryotherapy)[5]. Visual acuity was defined as visual acuity after subjective refraction in the ... Sprangers MAG, Fayers PM: The clinical significance of adaptation to changing health: A meta-analysis of response shift. Qual Life Res 2006, 15:1533-1550. 24. Barakat LP, Alderfer MA,...

Ngày tải lên: 20/06/2014, 16:20

8 254 0
Báo cáo y học: "Relationship among Dexamethasone Suppression Test, personality disorders and stressful life events in clinical subtypes of major depression: An exploratory study" pot

Báo cáo y học: "Relationship among Dexamethasone Suppression Test, personality disorders and stressful life events in clinical subtypes of major depression: An exploratory study" pot

... Fountoulakis KN, Iacovides A, Ioannidou C, Bascialla F, Nimatoudis I, Kaprinis G, Janca A, Dahl A: Reliability and cultural applicability of the Greek version of the International Personality Disor- ders ... with Luminance Immunoassay (intra-essay reli- ability: 4.9%; inter-essay: 7.5%). Non-suppression cut-off level: 5 µg/dl. Statistical Analysis Multiple Analysis of Variance (MANOVA) w...

Ngày tải lên: 08/08/2014, 20:23

8 415 0
Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx

Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx

... Quantitative analysis of cytokine gene expression in rheumatoid arthritis. J Immunol 1990, 144:3347-3353. 13. Morita Y, Yamamura M, Kawashima M, Harada S, Tsuji K, Shibuya K, Maruyama K, Makino ... Mukaida N, Mahe Y, Matsushima K: Cooperative interaction of nuclear factor-κB- and cis-regulatory enhancer binding pro- tein-like factor binding elements in activating the interleukin-8 gen...

Ngày tải lên: 09/08/2014, 08:23

10 456 0
Báo cáo y học: "Deficiency of functional mannose-binding lectin is not associated with infections in patients with systemic lupus erythematosu" pptx

Báo cáo y học: "Deficiency of functional mannose-binding lectin is not associated with infections in patients with systemic lupus erythematosu" pptx

... carbohy- drate-binding domain was concluded from its ability to inhibit binding of MBL to mannan (data not shown). Assessment of MBL pathway activation MBL pathway activation was assessed by an ... mannose-binding lectin; SLE, systemic lupus erythematosus. Table 4 Multivariate analysis of the first major infection (dependent variable) and clinical and therapy variables (independent v...

Ngày tải lên: 09/08/2014, 08:23

10 325 0
Báo cáo y học: "Rutoside decreases human macrophage-derived inflammatory mediators and improves clinical signs in adjuvant-induced arthritis" doc

Báo cáo y học: "Rutoside decreases human macrophage-derived inflammatory mediators and improves clinical signs in adjuvant-induced arthritis" doc

... they are capable of inducing other proinflammatory cytokines and activating matrix metalloprotei- nases in autocrine and paracrine fashions [2]. Inhibitors of IL- 1 and TNF-α cause a reduction in ... 2004, 50:1457-1467. 5. Kawanaka N, Yamamura M, Aita T, Morita Y, Okamoto A, Kawashima M, Iwahashi M, Ueno A, Ohmoto Y, Makino H: CD14 + , CD16 + blood monocytes and joint infl...

Ngày tải lên: 09/08/2014, 10:22

9 397 0
Báo cáo y học: "Human articular chondrocytes express 15-lipoxygenase-1 and -2: potential role in osteoarthritis" pdf

Báo cáo y học: "Human articular chondrocytes express 15-lipoxygenase-1 and -2: potential role in osteoarthritis" pdf

... 5'- AGAGTTGTCCCGATGATCTC-3'; MMP-13, sense 5'-CTT AGA GGT GAC TGG CAA AC-3' and antisense 5'-GCC CAT CAA ATG GGT AGA AG-3'; and glyceraldehyde-3-phosphate dehydrogenase ... glyceraldehyde-3-phosphate dehydrogenase (GAPDH), sense 5'-CAGAACATCATCCCT- GCCTCT-3' and antisense 5'-GCTTGACAAAGTGGTCGTT- GAG-3'. Quantitative PCR analysis was perf...

Ngày tải lên: 09/08/2014, 14:20

12 771 0
w