Báo cáo y học: " Polychromatic immunophenotypic characterization of T cell profiles among HIV-infected patients experiencing immune reconstitution inflammatory syndrome (IRIS)" doc

... Research and Therapy Open Access Research Polychromatic immunophenotypic characterization of T cell profiles among HIV-infected patients experiencing immune reconstitution inflammatory syndrome ... solely the responsibility of the authors and does not necessarily represent the official views of the Fogarty International Center or the National Institutes of...

Ngày tải lên: 10/08/2014, 05:21

... 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢ Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala ... Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Tyr183Phe Sense strand 5¢-T...

Ngày tải lên: 22/02/2014, 04:20

... isoforms: chloroplastic Trx f or m [24,25] but also cytosolic Trx h [22,26]. We took advantage of this lack of speci®city t o try to isolate various putative Trx targets. AmutatedChlamydomonas cytosolic Trx ... to homogeneity by HPLC and digested with t rypsin. The tryptic peptides were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/or...

Ngày tải lên: 08/03/2014, 16:20

... absence of vitamin K. Together, these results indicate that the recombinant Conus carboxylase activity can be functionally expressed in two different eukaryotic systems. These results prove that the ... Whether the propeptide-binding site that directs carboxylation and the site that stimulates carboxylase activity are identical or separate remains unresolved. To study propeptide stimula- ti...

Ngày tải lên: 17/03/2014, 10:20

... multiplicity of targets may underlie the partial inhibition seen in our experiments, but further experiments are needed to fully elucidate the factors that cause partial inhibition. The structural ... content of cysteine residues [16]. Although the functions of most of the CRISP family proteins are unknown, some are thought to play roles in the immune system and sperm maturation [51...

Ngày tải lên: 18/03/2014, 01:20

... results indicate that ApTrx contains two extra cysteines but its activity is not affected by dithiothreitol, suggesting that the additional cysteine residues were not involved in regulating its enzymatic ... reactivated after preincubation with dithiothreitol [9,35]. ApTrx contains two extra cysteine residues, but its activity is not affected by preincubation with dithiothreitol, indicating t...

Ngày tải lên: 23/03/2014, 21:20

... … CTTGAGgtaagctctctaaca 0 371 bp 496 600 ttccttctggagc agGGTCTC … (exon 5, 105 bp) … TTCGACgtgagtaacagtgtc 0 74 bp 601 2031 tttcttgtgttgc agGTGGAT … (exon 6, 1431 bp) … AATAAATACTTGTGGAATAT G Ó ... all the other introns have the typical GT-AG splice junctions. For the first exon the transcription start site is shown instead of a 3¢ splice site. For the last exon the polyadenylation signal .....

Ngày tải lên: 23/03/2014, 21:20

... 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢. c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and 5¢ -T CCCAAAGCTCATGTCATAAG-3¢. d Generated ... 2). The heavy glycosylation, suggested by the staining behaviour of the protein, might explain at least a part of this discrepancy. The carbohydrate might...

Ngày tải lên: 24/03/2014, 04:21

... significant only versus patients with SLE and with Figure 2 Anti-Sip1 C-ter antibodies in patients and healthy subjectsAnti-Sip1 C-ter antibodies in patients and healthy subjects. Anti-car- boxy-terminal ... of the study. AS partic- ipated in the analysis and interpretation of data and helped to draft the manuscript. RR participated in the design of the study and in the revision...

Ngày tải lên: 09/08/2014, 08:22

... by human lymphocytes To examine the biological activity of HuMAbs in vitro,a cell- based assay was employed that measures inhibitory effects on SEB-induced secretion of proinflammatory cytokines by human ... high-affinity SEB-specif ic antibo- dies with potent biological activity towards SEB. This report details the characterization of these antibodies thus providing detailed informa...

Ngày tải lên: 11/08/2014, 08:21