Báo cáo y học: " Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy and HIV-uninfected controls: A substudy of the Multicenter AIDS Cohort Study" potx

Báo cáo y học: "Skeletal muscle sodium glucose co-transporters in older adults with type 2 diabetes undergoing resistance training"

Báo cáo y học: "Skeletal muscle sodium glucose co-transporters in older adults with type 2 diabetes undergoing resistance training"

... controlled trial of resistance exercise training to improve glycemic control in older adults with type 2 diabetes. Diabetes Care 20 02; 25( 12) :23 35-41. 15. Ivy JL. Role of exercise training in the prevention ... Skeletal muscle sodium glucose co-transporters in older adults with type 2 diabetes undergoing resistance training Francisco Cast...

Ngày tải lên: 31/10/2012, 17:08

8 604 0
Báo cáo y học: " γ δ Vγ9/Vδ2 T lymphocytes in Italian patients with Behçet’s disease – evidence for expansion, and tumour necrosis factor receptor II and interleukin-12 receptor β1 expression in active disease" pptx

Báo cáo y học: " γ δ Vγ9/Vδ2 T lymphocytes in Italian patients with Behçet’s disease – evidence for expansion, and tumour necrosis factor receptor II and interleukin-12 receptor β1 expression in active disease" pptx

... trigger the development of Behỗets disease [9,1517]. In the present study we analyzed γ/ δ T lymphocytes with phenotype Vγ9/Vδ2 in Italian patients with active and inac- tive Behỗets disease. ... lymphocytes in Italian patients with Behỗets disease – evidence for expansion, and tumour necrosis factor receptor II and interleukin-...

Ngày tải lên: 09/08/2014, 01:23

7 373 0
Báo cáo khoa học: "Gastric outlet obstruction due to adenocarcinoma in a patient with Ataxia-Telangiectasia syndrome: a case report and review of the literature" pdf

Báo cáo khoa học: "Gastric outlet obstruction due to adenocarcinoma in a patient with Ataxia-Telangiectasia syndrome: a case report and review of the literature" pdf

... ataxia- telangiectasia patients is usually atypical, leading to delays in diagnosis. Case presentation: We report the case of a 20 year old ataxia-telangiectasia patient with gastric adenocarcinoma ... obstruction due to adenocarcinoma in a patient with Ataxia-Telangiectasia syndrome: a case report and review of the literature Iyore...

Ngày tải lên: 09/08/2014, 04:21

5 599 0
Báo cáo y học: "Vitamin D receptor gene BsmI polymorphisms in Thai patients with systemic lupus erythematosus" potx

Báo cáo y học: "Vitamin D receptor gene BsmI polymorphisms in Thai patients with systemic lupus erythematosus" potx

... has been demonstrated that patients with SLE have a lower level of 25 hydroxyvitamin D3 than do healthy controls [3]. In addition, high-dose 1,25-dihydroxyvitamin D3 and its analog may be useful ... pancreas, bone, skin, gonads, and activated T and B lymphocytes, have the nuclear receptor for 1,25-dihydroxyvitamin D3 (VDR). Thus, it is not surprising that 1,25-dihydroxyvitamin D3...

Ngày tải lên: 09/08/2014, 07:20

4 331 0
Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

... constrained by the number of joints with damage, and probably also by the level of damage in those joints. In fact, data from animal studies clearly indicate that once the matrix is resorbed the rate and extent ... arthritis appeared more than 30 years ago after the development of a method for scor- ing these abnormalities [1]. A decade and a half ago additional data bec...

Ngày tải lên: 09/08/2014, 10:20

9 374 0
Báo cáo y học: "Heterochronic evolution reveals modular timing changes in budding yeast transcriptomes" potx

Báo cáo y học: "Heterochronic evolution reveals modular timing changes in budding yeast transcriptomes" potx

... Late (c) E.YPS3060 M.YPS3060 L.YPS3060 E.YPS3137 M.YPS3137 L.YPS3137 L.YPS3395 E.YPS3395 M.YPS3395 L.YPS2073 E.YPS2073 M.YPS2073 L.YPS183 E.YPS183 M.YPS183 E.YPS2079 M.YPS2079 L.YPS2079 L.YPS2060 E.YPS2060 M.YPS2060 L.YPS2055 E.YPS2055 M.YPS2055 L.YPS2066 E.YPS2066 M.YPS2066 L.YPS2067 E.YPS2067 M.YPS2067 YPS3137 YPS3060 YPS3395 YPS2073 YPS2060 YPS183 YPS2066 YPS2055 YPS2079 YPS2067 YPS2073 YP...

Ngày tải lên: 09/08/2014, 22:23

17 309 0
Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

... 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCC Rsf1 7:104809403-4 GACACTAAAAGTAGAAAGCAGTCACC GCTTTTCTAGCTTTACAATGACTGG Sap30bp 11:115825338 CAACACAGGAAATGGACACG AACCAACAGGACCCAGAGG U1 ... CATCTGCAGGACTGCCTAGC TGGGACTTGACCTCTTCTGC Olfr424 1:176066876 GGACAAAGAATAACACAGATTTTCC GAACAAAGGAATGAAGAAGAGG Olfr573-ps1 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGT...

Ngày tải lên: 09/08/2014, 23:20

19 319 0
Báo cáo y học: " Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy and HIV-uninfected controls: A substudy of the Multicenter AIDS Cohort Study" potx

Báo cáo y học: " Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy and HIV-uninfected controls: A substudy of the Multicenter AIDS Cohort Study" potx

... citation purposes) AIDS Research and Therapy Open Access Research Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy ... Mahabadi AA, Massaro JM, Rosito GA, Levy D, Murabito JM, Wolf PA, O'Donnell CJ, Fox CS, Hoffmann U: Association of pericardial fat, intrathoracic fat,...

Ngày tải lên: 10/08/2014, 05:21

8 407 0
báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx

báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx

... a man with trisomy 8 mosaicism: a case report and literature review. Journal of Medical Case Reports 2011 5:453. Submit your next manuscript to BioMed Central and take full advantage of: ã Convenient ... 5:453 http://www.jmedicalcasereports.com/content/5/1/453 Page 4 of 4 unable to actively perform a straight leg raise. On pal- pation, there was generalize d tend...

Ngày tải lên: 10/08/2014, 23:20

4 252 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... Access Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against ... al.: Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the...

Ngày tải lên: 11/08/2014, 08:21

7 394 0
Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

... report a case of a middle-aged man with tennis leg. Ultrasound examination had normal findings during the first two attempts. During the third attempt, with the patient s calf muscles examined in an ... revealed negative sonographic findings. However, he still complained of persistent pain in his left calf area. A different ultrasound examination approach was then...

Ngày tải lên: 11/08/2014, 17:21

4 316 0
Báo cáo y học: " Anaesthesia for serial whole-lung lavage in a patient with severe pulmonary alveolar proteinosis: a case report" pdf

Báo cáo y học: " Anaesthesia for serial whole-lung lavage in a patient with severe pulmonary alveolar proteinosis: a case report" pdf

... in alveolar macrophages. Although increasing evidence indicates that GM-CSF ther- apy may be beneficial for patients with PAP, the mainstay of treatment is whole-lung lavage (WLL). The postulated therapeutic ... separation under general anaesthesia and lavage of the non-ventilated lung remain the standard treatment for PAP since first employed by Ramirez-Rivera [2]. Anaesth...

Ngày tải lên: 11/08/2014, 19:21

3 339 0
Báo cáo y học: "Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature" pot

Báo cáo y học: "Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature" pot

... report Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature AsaMMargolis 1 , Andrew B Emmerman 1 , Mario Rascon 2 and Saima I Chaudhry* 1 Address: ... adenocarcinoma. Conclusion: This is the first reported case of asymptomatic epicarditis. Our case was especially unusua...

Ngày tải lên: 11/08/2014, 19:21

7 329 0
Báo cáo y học: " Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case report" docx

Báo cáo y học: " Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case report" docx

... report Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case report Elizabeth Ann Justice*, Sophia Yasmin Khan, Sarah Logan and Paresh ... additional adverse events compared with placebo. The most frequently reported adverse effects during acyclovir therapy are headache, nausea and abdominal cramping. W...

Ngày tải lên: 11/08/2014, 21:22

4 259 0
Báo cáo y học: "A role for age-related changes in TGFβ signaling in aberrant chondrocyte differentiation and osteoarthritis" ppt

Báo cáo y học: "A role for age-related changes in TGFβ signaling in aberrant chondrocyte differentiation and osteoarthritis" ppt

... expressed and synthesized by human chondrocytes but not by synoviocytes. A role in osteoarthritis. J Clin Invest 1996, 97:2011-2019. 7. Inada M, Wang Y, Byrne MH, Rahman MU, Miyaura C, Lopez-Otin ... observed by our own group during ageing and OA in murine models [52,53]. Moreover, proteoglycan synthesis is also diff erentially regulated by TGFβ in rabbit and bovine chon...

Ngày tải lên: 12/08/2014, 11:22

9 360 0
Từ khóa:
w