Báo cáo y học: " Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy and HIV-uninfected controls: A substudy of the Multicenter AIDS Cohort Study" potx

Báo cáo y học: "Skeletal muscle sodium glucose co-transporters in older adults with type 2 diabetes undergoing resistance training"

... controlled trial of resistance exercise training to improve glycemic control in older adults with type 2 diabetes. Diabetes Care 20 02; 25( 12) :23 35-41. 15. Ivy JL. Role of exercise training in the prevention ... Skeletal muscle sodium glucose co-transporters in older adults with type 2 diabetes undergoing resistance training Francisco Castaneda1, Jennifer E. Layne 2 , and Carmen Castaneda 2 1. Max ... have diabetes. Approximately 90-95% of people who are diagnosed with diabetes have type 2 diabetes. It results from insulin resistance combined with relative insulin deficiency [1]. Both insulin...

Báo cáo y học: " γ δ Vγ9/Vδ2 T lymphocytes in Italian patients with Behçet’s disease – evidence for expansion, and tumour necrosis factor receptor II and interleukin-12 receptor β1 expression in active disease" pptx

... triggerthe development of Behỗets disease [9,1517]. In the present study we analyzed γ/ δ T lymphocytes with phenotype Vγ9/Vδ2 in Italian patients with active and inac-tive Behỗets disease. ... lymphocytes in Italian patients with Behỗets disease – evidence for expansion, and tumour necrosis factor receptor II and interleukin-12 receptor ββ1 expression in active disease Giovanni Triolo1, ... 4 Tumour necrosis factor receptor II (TNF-RII) and IL-12 receptor β1(IL-12Rβ1) expression of Vγ9/Vδ2 T lymphocytes from a patient with active Behỗets disease (BD). The ordinate indicates the...

Báo cáo khoa học: "Gastric outlet obstruction due to adenocarcinoma in a patient with Ataxia-Telangiectasia syndrome: a case report and review of the literature" pdf

... ataxia-telangiectasia patients is usually atypical, leading to delays in diagnosis. Case presentation: We report the case of a 20 year old ataxia-telangiectasia patient with gastric adenocarcinoma ... obstruction due to adenocarcinoma in a patient with Ataxia-Telangiectasia syndrome: a case report and review of the literatureIyore A Otabor1, Shahab F Abdessalam2, Steven H Erdman3, Sue Hammond4 ... gastritis and intestinal metaplasia seem to lead to the development of gastric adenocarcinoma. One should consider adenocarcinoma in any patient with ataxia-telangiectasia who presents with non-specific...

Báo cáo y học: "Vitamin D receptor gene BsmI polymorphisms in Thai patients with systemic lupus erythematosus" potx

... has beendemonstrated that patients with SLE have a lower level of 25hydroxyvitamin D3 than do healthy controls [3]. In addition,high-dose 1,25-dihydroxyvitamin D3 and its analog may beuseful ... pancreas,bone, skin, gonads, and activated T and B lymphocytes, havethe nuclear receptor for 1,25-dihydroxyvitamin D3 (VDR).Thus, it is not surprising that 1,25-dihydroxyvitamin D3 has amultitude of ... controls and 101 patients with SLE. However, this is in accordance with previous findings in the Thai population[24]. Thailand is geographically situated in an area betweenChina and India. This genetic...

Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

... constrained by thenumber of joints with damage, and probably also by the levelof damage in those joints. In fact, data from animal studiesclearly indicate that once the matrix is resorbed the rate and extent ... arthritis appeared morethan 30 years ago after the development of a method for scor-ing these abnormalities [1]. A decade and a half ago additionaldata became available to validate the term 'disease ... http://arthritis-research.com/content/9/4/R62Page 1 of 9(page number not for citation purposes)Vol 9 No 4Research articleExpert agreement confirms that negative changes in hand and foot radiographs are a surrogate...

Báo cáo y học: "Heterochronic evolution reveals modular timing changes in budding yeast transcriptomes" potx

... Late(c)E.YPS3060M.YPS3060L.YPS3060E.YPS3137M.YPS3137L.YPS3137L.YPS3395E.YPS3395M.YPS3395L.YPS2073E.YPS2073M.YPS2073L.YPS183E.YPS183M.YPS183E.YPS2079M.YPS2079L.YPS2079L.YPS2060E.YPS2060M.YPS2060L.YPS2055E.YPS2055M.YPS2055L.YPS2066E.YPS2066M.YPS2066L.YPS2067E.YPS2067M.YPS2067YPS3137YPS3060YPS3395YPS2073YPS2060YPS183YPS2066YPS2055YPS2079YPS2067YPS2073YPS3395YPS3137YPS3060YPS183YPS2060YPS2079YPS2055YPS2066YPS2067YPS183YPS3395YPS2073YPS2067YPS2055YPS2066YPS2060YPS2079YPS3137YPS3060Average ... Late(c)E.YPS3060M.YPS3060L.YPS3060E.YPS3137M.YPS3137L.YPS3137L.YPS3395E.YPS3395M.YPS3395L.YPS2073E.YPS2073M.YPS2073L.YPS183E.YPS183M.YPS183E.YPS2079M.YPS2079L.YPS2079L.YPS2060E.YPS2060M.YPS2060L.YPS2055E.YPS2055M.YPS2055L.YPS2066E.YPS2066M.YPS2066L.YPS2067E.YPS2067M.YPS2067YPS3137YPS3060YPS3395YPS2073YPS2060YPS183YPS2066YPS2055YPS2079YPS2067YPS2073YPS3395YPS3137YPS3060YPS183YPS2060YPS2079YPS2055YPS2066YPS2067YPS183YPS3395YPS2073YPS2067YPS2055YPS2066YPS2060YPS2079YPS3137YPS3060Average ... co-regulatedgenes may exhibit coordinated shifts in expression timing patterns during evolutionary divergence. Here, weexamined transcriptome evolution in the dynamical context of the budding yeast cell-division...

Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

... 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCCRsf1 7:104809403-4 GACACTAAAAGTAGAAAGCAGTCACC GCTTTTCTAGCTTTACAATGACTGGSap30bp 11:115825338 CAACACAGGAAATGGACACG AACCAACAGGACCCAGAGGU1 ... CATCTGCAGGACTGCCTAGC TGGGACTTGACCTCTTCTGCOlfr424 1:176066876 GGACAAAGAATAACACAGATTTTCC GAACAAAGGAATGAAGAAGAGGOlfr573-ps1 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGTGGAGAGGOlfr749 ... 2:121223476 CTGGATGTCTTACACTCACTACACTGC CTATATGTACAGAGGGACCAGTCTTGGCol 6a3 1:92672331 CAGGCATAAAAGATGGTGTCTCTAAG GACCAAACCAACAGCAATTGTAAACCreb3l2 6:37284584 GATGCCCTGAGCAGAGAGG TGCAGAAAGCCAAACCTAGCGm10859...

Báo cáo y học: " Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy and HIV-uninfected controls: A substudy of the Multicenter AIDS Cohort Study" potx

... citation purposes) AIDS Research and TherapyOpen AccessResearch Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy ... Mahabadi AA, Massaro JM, Rosito GA, Levy D, Murabito JM, Wolf PA,O'Donnell CJ, Fox CS, Hoffmann U: Association of pericardial fat, intrathoracic fat, and visceral abdominal fat with cardiovas-cular ... rapidly in HIV-infected men who had clinical evidence of lipodystrophy, compared to the HIV-infected men without lipodystrophy AIDS Research and Therapy 2009, 6:8 http://www.aidsrestherapy.com/content/6/1/8Page...

báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx

... a man with trisomy 8 mosaicism: a case report and literature review. Journal of Medical Case Reports 2011 5:453.Submit your next manuscript to BioMed Central and take full advantage of: ã Convenient ... 5:453http://www.jmedicalcasereports.com/content/5/1/453Page 4 of 4 unable to actively perform a straight leg raise. On pal-pation, there was generalize d tenderness and a highriding patella with a palpable gap beneath it consistent with a patellar ... O.During the operative repair, his patellar tendon wasfound to be avulsed off the inferior pole of his patella. A repair was accomplished by weaving sutures throughthe patellar tendon and drill...

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... AccessPrior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against ... al.: Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV. ... Ruprecht2,4AbstractBackground: We have evaluated an attenuated Listeria monocytogenes (Lm) candidate vaccine vector in nonhuman primates using a delivery regimen relying solely on oral vaccination....

Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

... report a case of a middle-aged man with tennisleg. Ultrasound examination had normal findings during the first two attempts. During the thirdattempt, with the patient s calf muscles examined in an ... revealednegative sonographic findings. However, he still complained of persistent pain in his left calf area. A different ultrasound examination approach was then performed with the patient lying in the supineposition ... bony fractures.The patient returned to the clinic one week latercomplaining that the pain in his left calf area persistedand could be further aggravated by tiptoeing and weightbearing maneuvers....

Báo cáo y học: " Anaesthesia for serial whole-lung lavage in a patient with severe pulmonary alveolar proteinosis: a case report" pdf

... in alveolar macrophages.Although increasing evidence indicates that GM-CSF ther-apy may be beneficial for patients with PAP, the mainstayof treatment is whole-lung lavage (WLL). The postulatedtherapeutic ... separation undergeneral anaesthesia and lavage of the non-ventilated lungremain the standard treatment for PAP since firstemployed by Ramirez-Rivera [2]. Anaesthesia for WLL isundoubtedly hazardous: ... Investigations reveal radiographic bilat-eral patchy air-space infiltration, restrictive pulmonary function, impaired diffusion capacity and milky broncho- alveolar lavage (BAL) fluid rich in...

Báo cáo y học: "Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature" pot

... report Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literatureAsaMMargolis1, Andrew B Emmerman1, Mario Rascon2 and Saima I Chaudhry*1Address: ... adenocarcinoma.Conclusion: This is the first reported case of asymptomatic epicarditis. Our case was especiallyunusual because the epicarditis presented as an incidental cardiac mass. The clinical ... significant for pallor and tachycardia. Laboratoryanalysis revealed a hemoglobin count of 7.2 g/dl and iron deficiency anemia. The patient wastransfused and evaluated by endoscopic ultrasound. A...

Báo cáo y học: " Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case report" docx

... report Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case reportElizabeth Ann Justice*, Sophia Yasmin Khan, Sarah Logan and Paresh ... additional adverse eventscompared with placebo. The most frequently reportedadverse effects during acyclovir therapy are headache,nausea and abdominal cramping. Whilst oral acyclovirhas a ... steroids alone,or the drug combination caused disseminated HSV-1 in our patient. In vivo data indicate that TNF-alpha may havean antiviral effect in HSV-1 infections. In a model in which HSV-1 was...

Báo cáo y học: "A role for age-related changes in TGFβ signaling in aberrant chondrocyte differentiation and osteoarthritis" ppt

... expressed and synthesized by human chondrocytes but not by synoviocytes. A role in osteoarthritis. J Clin Invest 1996, 97:2011-2019.7. Inada M, Wang Y, Byrne MH, Rahman MU, Miyaura C, Lopez-Otin ... observed by our own group during ageing and OA in murine models [52,53]. Moreover, proteoglycan synthesis is also diﬀ erentially regulated by TGFβ in rabbit and bovine chondrocytes depending on ... pathways are involved in TGFβ signaling (reviewed in [35]). Activation of TGFβ activated kinase 1 occurs independent of ALK5 kinase activity and results in P38 and JNK signaling [36].  at TGFβ activates...

Xem thêm

Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam