Báo cáo y học: "Thymic function and T cell parameters in a n

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... based on the method by Cawthon et al[33]. Briefly, commercially obtained telo- mere specific primers; CGGTTTGT TTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT ... 2008, 129:60-66. doi:10.1186/1423-0127-18-41 Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seaso...

Ngày tải lên : 10/08/2014, 05:21

11
527
0

Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc

... TGGACCGCAACAACGCCATCTATGA- GAAAACC and TGGAGCTGAAGCAATAGTTGGTATC- CAGGGCT. 3. β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGAT- GTCACGCACGATTTCC. Mixed lymphocyte reaction (MLR) and in- vitro cytokine ... determined by normalizing expression levels to that of β-actin. The primer sequences used were as follows: 1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC...

Ngày tải lên : 09/08/2014, 08:22

7
399
0

Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt

... participated in the design of the study and the interpretation of data, and helped to draft the manuscript. MAD per- formed the statistical analysis and helped to draft the manuscript. IG -A participated ... participated in the design of the study and also in collection of the data at the Hospital Universitario de la Princesa, was involved in the interpretation of...

Ngày tải lên : 09/08/2014, 13:22

10
426
0

Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx

... transport of electrons through the respiratory chain, increasing the time of interaction between these electrons and molecular oxygen and facilitating the formation of ROS. Activation of innate ... regulatory cycle. Finally, these data suggest the interesting possibility that UCP2 may serve as an anti- oxidant, guarding against an excess of oxygen free rad- icals. Further stud...

Ngày tải lên : 05/03/2014, 23:20

11
430
0

Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt

... anti-host cytotoxic T lymphocyte (CTL) activityEffect of hepatocyte growth factor (HGF) on host B cell activation and donor anti-host cytotoxic T lymphocyte (CTL) activity. Chronic graft-versus- host ... study. TI (Tsuyoshi Iwasaki) conceived of the study, participated in the design and coordination of the study, and participated in the interpretation of the results. J...

Ngày tải lên : 09/08/2014, 08:22

9
463
0

Báo cáo y học: "Retroviral rebound syndrome after treatment discontinuation in a 15 year old girl with HIV attracted through mother-to-child transmission: case report" doc

... four years until she started HAART when it became available 1996. At the time she was hospitalized and severely ill with a Mycobacterium avium intracellulare sepsis. After treatment initiation with ... treatment was stopped and the creatinine concentration normalized again within two months. Twelve days after the treatment discontinuation she pre- sented with fever (39–39.5°C), lymphade...

Ngày tải lên : 10/08/2014, 05:20

3
579
0

Báo cáo y học: " High-grade endometrial stromal sarcoma presenting in a 28-year-old woman during pregnancy: a case report" docx

... microsco- pically normal. Three days later, intestinal obstruction was diagnosed. We agreed that chemotherapy was not likely to be a clinical benefit for a high-grade sarcoma causing intestinal obstruction ... cancer complicating pregnancy. This is a result of t he realiza- tion that oncological treatment modalities, including surge ry and chemotherapy, can be applied after t he...

Ngày tải lên : 11/08/2014, 03:21

4
189
0

Báo cáo y học: "Parotid fistula secondary to suppurative parotitis in a 13-year-old girl: a case report" doc

... produce parotid fistula. There are various treatment options available, however it is necessary to standardize the treatment according to the duration of histor y and the patient’s general condition. Case ... salivary (parotid) fistula was made based on clinical examination and investigations. The parotid fistula was successfully managed. Conclusion: Parotid fistula secondary to suppu...

Ngày tải lên : 11/08/2014, 03:21

4
289
0

Báo cáo y học: "High-grade endometrial stromal sarcoma presenting in a 28-year-old woman during pregnancy: a case report" docx

... cancer complicating pregnancy. This is a result of t he realiza- tion that oncological treatment modalities, including surge ry and chemotherapy, can be applied after t he first gestational trimester ... upper abdomen. The disease at the level of the peritoneum was infiltrating the sub-peritoneal fat and this infiltration was responsible for the pain at the right fossa. The uter...

Ngày tải lên : 11/08/2014, 07:20

4
274
0

Báo cáo y học: " Parotid fistula secondary to suppurative parotitis in a 13-year-old girl: a case report" doc

... by glandular atrophy, thus allowing healing of the fistula [1]. Another form of treatment is tympanic nerve section, which has a low success rate and can take a long time to achieve healing of ... healing of the fistula [1]. The results of the latter two techniques are comparatively slow and unpredictable [6]. In the case of our patient, as it was a delayed presen- tat...

Ngày tải lên : 11/08/2014, 07:20

4
251
0