Báo cáo y học: "PLCb1-SHP-2 complex, PLCb1 tyrosine dephosphorylation and SHP-2 phosphatase activity: a new part of Angiotensin II signaling?" ppt

Báo cáo y học: "PLCb1-SHP-2 complex, PLCb1 tyrosine dephosphorylation and SHP-2 phosphatase activity: a new part of Angiotensin II signaling?" ppt

Báo cáo y học: "PLCb1-SHP-2 complex, PLCb1 tyrosine dephosphorylation and SHP-2 phosphatase activity: a new part of Angiotensin II signaling?" ppt

... and SHP-2 phosphatase activity: a new part of Angiotensin II signaling? Lorenzo A Calò 1*† , Luciana Bordin 2† , Paul A Davis 3 , Elisa Pagnin 1 , Lucia Dal Maso 1 , Gian Paolo Rossi 1 , Achille ... in part by a research grant from the Italian Society of Hypertension (SIIA) to LAC, by a grant from Italian Ministry of the University and Scientific and Tech...

Ngày tải lên: 10/08/2014, 05:21

7 331 0
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt

Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt

... human brain at therapeutic doses, * Correspondence: furuse@asahikawa-rch.gr.jp 1 Department of Psychiatry, Asahikawa Red Cross Hospital, Asah ikawa, Japan Furuse and Hashimoto Annals of General ... Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after single oral adminis...

Ngày tải lên: 08/08/2014, 23:21

3 404 0
 Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"

Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"

... interviews and self- administered questionnaires on lifestyle and health related factors, medical history and respiratory symptoms were performed. Cardiovascular (heart attack, stroke) and pul- monary ... University of Greifswald, Greifswald, Germany. 7 Central Hospital of Augsburg, MONICA/KORA Myocardial Infarction Registry, Augsburg, Germany. 8 Ludwig-Maximilians-University, Ins...

Ngày tải lên: 25/10/2012, 10:45

8 579 1
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... similar conditions. Pyridylamination of oligosaccharides Chemically and enzymatically released oligosaccharides were pyridylaminated according to Kuraya et al.[37]. Excess 2-aminopyridine and reaction ... permethylated and hydrolyzed. Partially methylated alditol acetates obtained after sodium borohydride reduction and peracetylation were analyzed by capillary GLC/MS using the instr...

Ngày tải lên: 31/03/2014, 08:20

15 482 0
Báo cáo y học: "Antibody-induced arthritis: disease mechanisms and genes involved at the effector phase of arthritis" ppsx

Báo cáo y học: "Antibody-induced arthritis: disease mechanisms and genes involved at the effector phase of arthritis" ppsx

... Miyazawa S, Nishida K, Komiyama T, Nakae Y, Takeda K, Yorim- itsu M, Kitamura A, Kunisada T, Ohtsuka A, Inoue H: Novel trans- dermal photodynamic therapy using ATX-S10.Na (II) induces Available ... 110:651-658. 85. Kamei D, Yamakawa K, Takegoshi Y, Mikami-Nakanishi M, Nakatani Y, Oh-Ishi S, Yasui H, Azuma Y, Hirasawa N, Ohuchi K, et al.: Reduced pain hypersensitivity and inflammation...

Ngày tải lên: 09/08/2014, 08:23

11 457 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

... optimal timing of Figure 3 Impact of abatacept on antibody titers at 14 and 28 days after vaccination in individual pneumococcal serotypesImpact of abatacept on antibody titers at 14 and 28 days after ... vaccines. Serum samples were obtained for subjects of Groups A and B at study days 14 and 28, for Group C subjects at study days 28 and 42, and for Group D subjects at...

Ngày tải lên: 09/08/2014, 10:20

11 415 0
Báo cáo y học: " Numbers needed to treat calculated from responder rates give a better indication of efficacy in osteoarthritis trials than mean pain scores" pptx

Báo cáo y học: " Numbers needed to treat calculated from responder rates give a better indication of efficacy in osteoarthritis trials than mean pain scores" pptx

... predominantly female (72%) and white (89%), were aged between 40 and 87 years, had a median duration of arthritis of 6 years, and were mostly diag- nosed as American Rheumatism Association class II/ III (85%). Most ... from dichotomous rather than continuous scores, using larger data sets and meta-analytic methods. Materials and methods To obtain a range of responses, we...

Ngày tải lên: 09/08/2014, 10:23

5 317 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

... morphology Hyaline cartilage 4 Mostly hyaline cartilage 3 Mostly fibrocartilage 2 Mostly non-cartilage 1 Noncartilage only 0 Matrix-staining (metachromasia) Normal (compared with host adjacent cartilage) ... transplanting mesenchymal stem cells as a potential treatment of cartilage defect Hideyuki Koga 1 , Masayuki Shimaya 1 , Takeshi Muneta 1,2 , Akimoto Nimura 1 , Toshiyuki Morito 1 ,...

Ngày tải lên: 09/08/2014, 10:23

10 470 0
Báo cáo y học: "Antiphospholipid antibody profiles in lupus nephritis with glomerular microthrombosis: a prospective study of 124 cases" pot

Báo cáo y học: "Antiphospholipid antibody profiles in lupus nephritis with glomerular microthrombosis: a prospective study of 124 cases" pot

... indicates that GMT may be associated with aPL that recognize antigens such as β2GPI and some hemostatic and fibrinolystic pro- teases instead of cardiolipin. β2GPI may act as a cofactor of aPL ... which is char- A2 : annexin II; aCL: anticardiolipin antibody; ANA: antinuclear antibodies; anti-dsDNA: anti-double-stranded DNA antibody; anti-RNP: anti-ribonucle- oprotein antibody; aP...

Ngày tải lên: 09/08/2014, 14:21

9 413 0
Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx

Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx

... analyzed as described [32]. The primer pair for nppa was F-GGCAACAGAA- GAGGCATCAGAG and R-GGAGCTGCTGCTTC CTCTCGGTC. The primer pair for b-actin was F- CCATTGGCAATGAGAGGTTCAG and R-T GAT GGAGTTGAAAGTGGTCTCG. Results Phenotypes ... 1A &1B). Pronounced pericardial edema accompanied by a linear arrangement of the ventricle and atrium which underwent bradycardia arrhythmia and the...

Ngày tải lên: 10/08/2014, 10:20

13 371 0
w