Báo cáo y học: "Precise pattern of recombination in serotone

Báo cáo y học: "Precise pattern of recombination in serotonergic and hypothalamic neurons in a Pdx1-cre transgenic mouse line" ppsx

... cell types. Serotonergic neurons, which comprise a tiny fraction of all neurons in the mammalian brain, play an important and unique role in many physiological functions, including the regulation * ... Zeg GFP/0 or Zeg GFP/GFP samples. Cre Any transgene containing cre (e.g., Pdx1-cre line) ACATT TGGG CCAG CTAAA CAT 200 CGG CATC AAC GTTT TCTT TT 200 GGC GAG AGC AGA GTGT GGA T...

Ngày tải lên : 10/08/2014, 05:21

13
258
0

Báo cáo y học: " Systematic monitoring of needs for care and global outcomes in patients with severe mental illness" ppsx

... negative Table 1: Mean change in GAF scores per year since first CNCM measurement years since baseline as a categorical variable years since baseline linear years since 1st assessment n Mean GAF (sd) β ... showed that the association between years since baseline and GAF or BPRS was not linear. There- fore, years since baseline was included as a categorical variable, formatted as dumm...

Ngày tải lên : 11/08/2014, 16:22

10
313
0

Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

... CF collected, analysed and interpreted the clinical data regarding the acute liver failure. GM was responsible for designing the study in terms of the clinical and virological data analysis and made a major ... antiviral drugs could prevent the need for liver transplantation or prevent a fatal outcome. Abbreviations AA: amino acids; ALT: alanine aminotransferase; AP: alka- line...

Ngày tải lên : 11/08/2014, 17:21

7
348
0

Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

... Matsuo K, Hamajima N, et al. Associations between polymorphisms in the thymidylate synthase and serine hy- droxymethyltransferase genes and susceptibility to malignant lymphoma. Haematologica. 2003; ... Perry IJ, et al. Hyperhomocystein- aemia, Helicobacter pylori, and coronary heart disease. Heart. 1997; 78: 524. 16. Saxena V, Markus H, Swaminathan S, et al. Hyperhomocys- teinaem...

Ngày tải lên : 31/10/2012, 14:34

7
578
1

Báo cáo y học: "Maternal use of Loratadine during pregnancy and risk of hypospadias in offspring"

... identification number, and the date of drug dispension. Since January 1 1989 all data from North Jutland County have been stored in a prescription database maintained by the Department of Clinical ... are available from January 1, 1996 (Aarhus County) and January 1, 1998 (Ringkoebing and Viborg counties). Drugs sold over the counter are not available in these Prescriptio...

Ngày tải lên : 02/11/2012, 10:09

5
528
0

Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"

... 4.53 3.3 TTCATCCGTCACAGG AGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAA CAAACG GGGCAAGTTCAGCAGAAACA decorin (Dcn) ... stream and scanned at 10 micron resolution using an Agilent Mi- croarray scanner G2565BA. Data was extracted using Agilent Feature Extractor Software (v7.1). Statistical data analysis. Al...

Ngày tải lên : 03/11/2012, 11:35

14
464
0

Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf

... activity and molecular stability of the mutants The catalytic activity and the molecular stability of the mutants were assayed because a change in either of these parameters would signiﬁcantly in uence ... !Ser/Asn147!Asp autolysis loop mutant had exactly the same molecular, enzymatic and autolytic properties as the Tyr146!His/Asn147 !Ser mutant. An Ala160!Leu variant of a...

Ngày tải lên : 22/02/2014, 07:20

9
613
0

Báo cáo Y học: Concerted regulation of free arachidonic acid and hormone-induced steroid synthesis by acyl-CoA thioesterases and acyl-CoA synthetases in adrenal cells pdf

... (ARTISt) and an acyl-CoA synthetase as members of an alternative pathway in the regulation of the intracellular levels of AA in steroidogenesis. Puriﬁed recombinant ARTISt releases AA from arachidonoyl-CoA ... enzyme and promotes AA release from AA-CoA. ACTH-stimulated steroid synthesis in Y1 cells was signiﬁcantly inhibited by a synergistic effect of NDGA and triacsin...

Ngày tải lên : 08/03/2014, 09:20

9
470
0

Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot

... expression between aerobically grown and anaerobically adapted c ul- tures. Another cDNA fragment (No. 7) indicated similarity to the 5¢ region of the Fe-hydrogenase from bacteria. Analysis of the hydA cDNA and ... solvent access [14]. In contrast to all Fe-hydrogenases including HydA of S. obliquus,the enzyme of C. reinhardtii has an interesting additional protein domain. A s...

Ngày tải lên : 08/03/2014, 22:20

11
469
0

Báo cáo Y học: The function of methyl-menaquinone-6 and polysul®de reductase membrane anchor (PsrC) in polysul®de respiration ofWolinella succinogenes doc

... several molybdo-oxidoreductases and is probably the catalytic subunit of Psr, which carries molybdenum coordinated by molybdopterin guanine dinucleotide. PsrA and PsrB are predicted to carry one and ... MK 4 (Sigma; c at. no. V-937 8) and v itamin K 1 (Fluka; cat. no. 95271) are commercially available. Activities of Psr and of polysul®de respiration The activity of Psr was m...

Ngày tải lên : 24/03/2014, 03:21

10
490
0