Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions Ronald P. de Vries 1† , Lucie Par ˇ enicova ´ 1‡ , Sandra W. A. Hinz 2 , ... Potato arabinogalactan consists of 86% D -galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D -galactose and 38% L -ar...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

... Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 Emily Crowley 1 , Megan L. O’Mara 2 , Ian D. Kerr 3 and Richard Callaghan 1 1 Nuffield Department ... indicate that TM12 plays a key role in the progression of the ATP hydrolytic cycle in ABCB1 and, in particular, in coordinating conformational c...

Ngày tải lên: 06/03/2014, 22:21

12 380 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion Tomoaki Hishida, Tsuyoshi Eguchi, Shigehiro Osada, Makoto ... results imply that fad49 is crucial in the immediate early stage of adipocyte differentiation. As fad49 appears to play an importan...

Ngày tải lên: 16/03/2014, 04:20

13 385 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

... 5Â-ACCACTCTCTGGATGTGATTGGA-3Â and 5Â- TCAAGAACATTTTATTTCCCACATTTT-3Â for Ugt2b5; 5Â-ATTGCCCATATGGTGGCCAAAGGAG-3Â and 5Â- GGCTGCCACACAAGCGAGTAGGAAT-3Â for Ugt2b37; 5Â-GGGAAGGACATGAAGGAGAGAGC-3Â and ... 5Â-AGAGATGATCCCATGAGAAACGG TGAA-3Â for Cyp 3a4 4; 5Â-AGATCATCATTCCTTGGCA CTGG-3Â and 5Â- ATTGCAGAAAGGAGGGAAGATGG -3Â for Cyp 4a1 0; 5Â-CCAGTTGAGTGACGAGGAG ATGG-3Â and 5Â-TCTGCATGCCCTCAAATGTTACC-...

Ngày tải lên: 16/03/2014, 14:20

9 280 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... component of the cell walls of Gram-negative bacteria, is an important microbial molecular pattern that initiates in ammatory and coagulation reactions as part of the host innate immune response to infection. ... decreasing TNF -a mRNA levels in MonoMac-6 cells. Taken together, the data from these studies suggest that LPCAT is a key enzyme in both the pathways of...

Ngày tải lên: 31/03/2014, 01:20

7 322 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... 4). Similarly, Shaanan [31] reported the stereochemistry of the iron -dioxygen bond in human HbO 2 by single-crystal X-ray analysis. In the a chain, the distance between N e of His (E7) and the terminal ... HbO 2 , and 50 l M for valency hybrid Hb. Ó FEBS 2002 The a1 b1 contact in HbO 2 autoxidation (Eur. J. Biochem. 269) 207 The a1 b1 contact of...

Ngày tải lên: 31/03/2014, 15:20

10 648 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

... Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in blood stimulated by a wide array of platelet agonists including atherosclerotic plaque. By specifically ... stimulus-induced platelet secretion and aggregation in blood. Methods: Human platelet aggregation and ATP -secretion were measured in hirudin-ant...

Ngày tải lên: 18/06/2014, 16:20

10 441 0
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

... RESEARC H Open Access LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury Keri B Vartanian, Susan L Stevens, ... lead to NFBactiva- tion and pro-inflammatory responses. In contrast, TLR signaling pathways that a ctivate IRFs can induce anti- inflammatory mediators an...

Ngày tải lên: 19/06/2014, 22:20

12 216 0
Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx

Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx

... an alpha2delta ligand, reduces the development of experimental osteoarthritis by inhibiting metalloproteinases and inducible nitric oxide synthase gene expression and synthesis in carti- lage chondrocytes. ... good quality of life. Consequently, the challenge of improving the ACL: anterior cruciate ligament; ASU: avocado/soybean unsaponifiables; iNOS: inducible n...

Ngày tải lên: 09/08/2014, 14:20

9 547 0
Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

... RESEA R C H Open Access Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla Samuel ... article as: Chan et al.: Extracellular signal-r egulated kinase 1/2 plays a pro-life role in experimental brain stem death via...

Ngày tải lên: 10/08/2014, 05:21

9 201 0
Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps

Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps

... article as: Dai et al.: Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla. Journal ... activation by HIF-1 in RVLM plays a preferential pro-life role by sustaining central cardiovascular regulatory functions during brain stem...

Ngày tải lên: 10/08/2014, 05:21

12 123 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... 11:19 http://www.biomedcentral.com/1471-2229/11/19 Page 8 of 10 RESEARCH ARTICLE Open Access The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis Hatem ... Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi H:...

Ngày tải lên: 11/08/2014, 11:21

10 427 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

... CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- TAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG- TTTTTGCTGTACGTACAGCAAAAACTATT ... GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG- TTTTTGCTGTACGTACAGCAAAAACTATT CTTA- AT GCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTA...

Ngày tải lên: 13/08/2014, 01:20

12 337 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

... 98:5306-5311. 41. Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchi- yama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx J, ... the hepatocyte and protects the normal paren- chyma against liver injury [32]. Jak2 participates in transduc- tion of interleukin (IL)6 signaling in case of acu...

Ngày tải lên: 14/08/2014, 08:20

14 385 0
Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf

Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf

... Zhang et al.: Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells. Genetic Vaccines and Therapy 2011 9:3. Submit ... natriuretic peptide signaling in modulating asthma and inflammation. Can Physiol Pharmacol 2007, 85:754-9. 3. Piechota M, Banach M, Jacon...

Ngày tải lên: 14/08/2014, 19:22

12 268 0
Từ khóa:
w