Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-NagaiM, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, KikuchiH, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Research and TherapyOpen AccessResearchTwo specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathwaysEmmanuel ... N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga M, Yamamoto N, Fujii M: Bay 11-7082 inhibits tran-scription factor NF-kappaB and induces apoptosis of HTLV-I -infected T-cell...
- 16
- 391
- 0
Báo cáo y học: "Severe synergistic toxicity from docetaxel in a patient treated concurrently with protease inhibitors as part of HIV post-exposure prophylaxis: a case report" doc
... and differential, normal renal function and normal hepatic function. She was admitted on day 6 of the cycle with febrile neutropenia, grade 2 mucositis and grade 2 arthralgia and myalgia. Apart ... heroesophagogastroduodenoscopy (OGD) and flexible sig-moidoscopy revealed widespread ulceration in the eso-phagus and gastric antrum that was biopsied. Meanwhile, a galactomannan antigen assay for Aspergillus and fungalcultures ... patientstreated with paclitaxel and HAART [11,12], although the consequences may not appear as severe, possibly because the metabolism of paclitaxel is less dependent on the CYP 3A4 pathway [5].More data...
- 5
- 296
- 0
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major ad-verse cardiac events; MI: myocardial infarction; ... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar-tery disease (CAD; 4). Also the ... study were comparable with the Taxus VI popu-lation To understand the safety and performance of the ZES and PES in the real-world patients, (patients not subject to any anatomic or clinical...
- 6
- 550
- 0
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"
... important given the frequency of femoral and acetabular defects asso-ciated with THA infections [7-9]. The aim of a two-stage revision is to eradicate any residual bacteria after removal of the ... use of PROSTALAC for the 2-stage revision of infected THA. The cement of the femoral head articulated with the bone of the acetabular bed causing bone erosion and discomfort. An acetabular ... periarticular scarring and muscle contractures adding to the morbidity and substantial impairment of patients’ normal daily activities during the pro-longed course of treatment. Another drawback of the...
- 5
- 549
- 0
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt
... (asynchr.)was also analyzed. The percentage of cells in the G0/G1, S, and G2/Mphases of the cell cycle at each time point was determined by FACSanalysis and is shown at the bottom.Fig. 4. Translation of ... 5¢-GGGAATTCTCAGATAGAGTCTTCTCTGGGAGC-3¢SG50: 5¢-GGGGACCAGGGTGACCGCGG-3¢SG92: 5¢-GCGCGGGAGATCTAACGGACGG-3¢SG108: 5¢-CCTCTAGACGCGCCGTCCGGTGCTGACTCAT-3¢SG109: 5¢-GGGGATCCATGCCATCAAAAATAAGGATTAAT-3¢SG142: ... Exon2-mut-luc), and compared itsactivity to the activity of Exon2-luc in transient transfectionassays. The mutation led to complete loss of activity in theseassays, indicating that the integrity of the AUG...
- 7
- 323
- 0
Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx
... insertion of a selenocysteine in mammalGPXs. The selenocysteine residue is important for the catalytic activity of GPX as replacement of selenocysteine bycysteine greatly reduces the activity of the ... variationsin the tissue and the subcellular concentrations of substrates and reducing substrates, dual catalytic activities for a givenenzyme might constitute an economical way plant cells haveevolved ... peroxideconcentrations. The data were analyzed by a Linewaever–Burk representation. Apparent maximum velocities (App. Vmax), apparent maximumMichaelis constant (App. Km) values (± SEM) and Vmax/Kmratios...
- 7
- 362
- 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTCCTCGACCAAAAAGATC; rcpA:forward,GCGATAGAATTCATGAGCGTAGAAACGGAAGAC and reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; cphB:forward,GCGATAGAATTCATG ... phytochrome-likeproteins of cyanobacteria (Calothrix sp. CphA and -B, Synechocystis sp. Cph1, and Anabaenasp. AphA and AphB, GenBank numbersAB028873 and AB034952), Arabidopsis thali-ana (At phyA and -C) and Solanum ... cphB:forward,GCGATAGAATTCATG ACGAATTGCGATCGCGA and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTTTGACCTCCTGCAATGT; cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; the reverseprimer was identical to that used...
- 10
- 499
- 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx
... several stabilizingvan der Waals’ contacts between the O4¢ atoms of the DNAsugars and distamycin atoms are observed.Rings A and B make an angle of 8.6 °,ringsBandC21.1 °, and ring C makes an angle ... chemical calculations infurther analysis of crystallographic results, a combinationTable 3. Close contacts of atoms in the minor groove of d(GGCCAATTGG) or d(CGCAAATTTGCG) and distamycin atoms. ... the possible attraction that can be achieved by this part of the drug and a CG base pair, we alleviated all constraints during the optimization. A completely unconstrained gas phaseoptimization of the...
- 10
- 411
- 0
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... Example of calculation of the index of the quantity of allergen -specific Th cells and the number of precursor cells of acquired allergen -specific cells (needed to calculate the absolute count of ... allergen -specific Thor B cells was based on the ability of the cells to prolif-erate. We assumed that all allergen -specific cells prolif-erated and that their death rate during the 7 days of culture ... childrenwith and without egg allergy. Clin Exp Allergy 2007, 37:1519-27.15. Karjalainen EM, Lindqvist A, Laitinen LA, Kava T, Altraja A, Halme M,Laitinen A: Airway inflammation and basement membrane...
- 12
- 334
- 0
Báo cáo y học: "Cartilage-specific autoimmunity in animal models and clinical aspects in patients – focus on relapsing polychondritis" ppsx
... half of the RPpatients the cartilage of the tracheolaryngeal tract isaffected. This is a potentially fatal symptom caused by a collapse of tracheal rings and bronchi and/ or by inflamma-tory ... RP and also indi-cates that shared pathogenic pathways might be used inRP and RA. As large variations in the severity and targets of the inflammatory attack appear in patients with RP and RA, ... the nasal septum (a) and in the laryngeal part of the respiratory tract (b) with an influx consisting mainly of neutrophils but also of lymphocytes, macrophages and eosinophils. Hematoxylin and...
- 6
- 264
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ