Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi H, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Research and Therapy Open Access Research Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF...

Ngày tải lên: 10/08/2014, 05:21

16 391 0
Báo cáo y học: "Severe synergistic toxicity from docetaxel in a patient treated concurrently with protease inhibitors as part of HIV post-exposure prophylaxis: a case report" doc

Báo cáo y học: "Severe synergistic toxicity from docetaxel in a patient treated concurrently with protease inhibitors as part of HIV post-exposure prophylaxis: a case report" doc

... and differential, normal renal function and normal hepatic function. She was admitted on day 6 of the cycle with febrile neutropenia, grade 2 mucositis and grade 2 arthralgia and myalgia. Apart ... her oesophagogastroduodenoscopy (OGD) and flexible sig- moidoscopy revealed widespread ulceration in the eso- phagus and gastric antrum that was biopsied. Meanwhile, a galacto...

Ngày tải lên: 11/08/2014, 14:20

5 296 0
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

... ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major ad- verse cardiac events; MI: myocardial infarction; ... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar- tery disease...

Ngày tải lên: 25/10/2012, 11:18

6 550 0
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"

Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"

... important given the frequency of femoral and acetabular defects asso- ciated with THA infections [7-9]. The aim of a two-stage revision is to eradicate any residual bacteria after removal of the ... use of PROSTALAC for the 2-stage revision of infected THA. The cement of the femoral head articulated with the bone of the acetabular bed causing bone er...

Ngày tải lên: 26/10/2012, 09:53

5 549 0
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt

Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt

... (asynchr.) was also analyzed. The percentage of cells in the G0/G1, S, and G2/M phases of the cell cycle at each time point was determined by FACS analysis and is shown at the bottom. Fig. 4. Translation of ... 5¢-GGGAATTCTCAGATAGAGTCTTCTCTGG GAGC-3¢ SG50: 5¢-GGGGACCAGGGTGACCGCGG-3¢ SG92: 5¢-GCGCGGGAGATCTAACGGACGG-3¢ SG108: 5¢-CCTCTAGACGCGCCGTCCGGTGCTGAC TCAT-3¢ SG109:...

Ngày tải lên: 08/03/2014, 09:20

7 323 0
Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx

Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx

... insertion of a selenocysteine in mammal GPXs. The selenocysteine residue is important for the catalytic activity of GPX as replacement of selenocysteine by cysteine greatly reduces the activity of the ... variations in the tissue and the subcellular concentrations of substrates and reducing substrates, dual catalytic activities for a given enzyme might constitute...

Ngày tải lên: 08/03/2014, 22:20

7 362 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

... ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ... phytochrome-like proteins of cyanobacteria (Calothrix sp. CphA and -B, Synechocystis sp. Cph1, and Anabaena sp. AphA and AphB, GenBank numbers AB028873 and AB034952), Arabido...

Ngày tải lên: 08/03/2014, 23:20

10 499 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

... several stabilizing van der Waals’ contacts between the O4¢ atoms of the DNA sugars and distamycin atoms are observed. Rings A and B make an angle of 8.6 °,ringsBandC 21.1 °, and ring C makes an angle ... chemical calculations in further analysis of crystallographic results, a combination Table 3. Close contacts of atoms in the minor groove of d(GGCCAATTGG) or d(CGCA...

Ngày tải lên: 24/03/2014, 04:21

10 411 0
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx

Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx

... Example of calculation of the index of the quantity of allergen -specific Th cells and the number of precursor cells of acquired allergen -specific cells (needed to calculate the absolute count of ... allergen -specific Th or B cells was based on the ability of the cells to prolif- erate. We assumed that all allergen -specific cells prolif- erated...

Ngày tải lên: 08/08/2014, 21:20

12 334 0
Báo cáo y học: "Cartilage-specific autoimmunity in animal models and clinical aspects in patients – focus on relapsing polychondritis" ppsx

Báo cáo y học: "Cartilage-specific autoimmunity in animal models and clinical aspects in patients – focus on relapsing polychondritis" ppsx

... half of the RP patients the cartilage of the tracheolaryngeal tract is affected. This is a potentially fatal symptom caused by a collapse of tracheal rings and bronchi and/ or by inflamma- tory ... RP and also indi- cates that shared pathogenic pathways might be used in RP and RA. As large variations in the severity and targets of the inflammatory attack appear...

Ngày tải lên: 09/08/2014, 06:22

6 264 0
Từ khóa:
w