Báo cáo y học: "Provider-initiated HIV testing in rural Haiti: low rate of missed opportunities for diagnosis of HIV in a primary care clinic" ppsx
... uptake of HIV testing and minimal delay between first medical encounter and diagnosis of HIV infection. In scale up of HIV care, provider- initiated HIV testing at primary care clinics can be a ... care in central Haiti by reinforcing primary care clinics, instituting provider-initiated HIV testing and by providing HIV treatment in the context of...
Ngày tải lên: 10/08/2014, 05:20
... relatively contra- indicated during allergy skin testing. The American Academy of Allergy Asthma & Immunology (AAAAI) outlines t his in its position statement, stating that “Sys- temic reactions ... immunotherapy for three reasons. They may: 1) worsen anaphylaxis severity; 2) make treatment of anaphylaxis more difficult; and 3) increase the inci- dence of anaphylaxis itself. Fi...
Ngày tải lên: 08/08/2014, 21:20
... early inflammatory reactions as well, in this particular study, an acute arthritis score of 0.5 was given if at least two interphalangeal, meta- carpo-phalangeal, or metatarso-phalangeal joints ... separated about 70 years ago and the corresponding microarray results indicate that, indeed, a single or a limited number of mutations may dramatically affect the clinical phe- notype of...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps
... activity) was elevated on day 3 in tibial cartilage and on days 3 and 7 in patellar cartilage, but no longer was by day 21. Increased NITEGE staining (indicating aggrecanase activity) was found ... GACGTTAGCGGTGTTGGGAG Collagen III 0.997 2.05 CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTT...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Dynamic compression counteracts IL-1β induced inducible nitric oxide synthase and cyclo-oxygenase-2 expression in chondrocyte/agarose constructs" pdf
... 5'-FAM-CGCGATCCCTGCTTGGTGGCGAAGATGAGCGATCGCG-DABCYL- 3' Forward: 5'-GTAACAAAGGAGATAGAAACAACAGG-3' Reverse: 5'- CAGCTCCGGGCGTCAAAG-3' 81 1.98 ± 0.06 COX-2 AF031698 Probe: 5'-FAM-CGCGATC GTCAGAAATTCGGGTGTGGTACAGTTGATCGCG- DABCYL-3' ... 5'-FAM-CGCGAT GCGTCAGGTCAGGTCAGCCATATCGCG-DABCYL-3' Forward: 5'-AAACCCGAACCCAGAACC-3' Reverse: 5&apo...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Green tea polyphenol epigallocatechin-3-gallate inhibits advanced glycation end product-induced expression of tumor necrosis factor-α and matrix metalloproteinase-13 in human chondrocyte" ppsx
... p38-MAPK and JNK activation. In addition, EGCG inhibited the phosphorylating activity of IKKβ kinase in an in vitro activity assay and EGCG inhibited the AGE- mediated activation and DNA binding activity ... the pathogenesis of inflammatory arthritis and are being studied as a rational target for arthritis therapy [54]. The activation of RAGE stimulates critical signaling path...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: "Positive anti-citrullinated protein antibody status and small joint arthritis are consistent predictors of chronic disease in patients with very early arthritis: results from the NOR-VEAC cohort" pot
... Metacarpo-phalangeal joint, proximal interphalangeal joint, or metatarso-phalangeal joint joint swelling.*P < 0.25, variable selected for inclusion in multivariate analyses. ACPA = anti-citrullinated ... Silman AJ: An evaluation of the decision tree format of the American College of Rheumatology 1987 classification criteria for rheumatoid arthritis: performance over five years...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Relationship between anti-dsDNA, anti-nucleosome and anti-alpha-actinin antibodies and markers of renal disease in patients with lupus nephritis: a prospective longitudinal study" pdf
... immunosorbent assay tests ODs from all of the assays were converted to absorbance ratios (ARs) to standardise the data and minimise interassay variation. The mean OD for each sample was calculated from the ... Com- mittee. Renal outcome measures For each patient at each time point, urine was tested for pro- tein/creatinine ratio (PCR), and serum was tested for albumin and creatinin...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Baseline resistance to nucleoside reverse transcriptase inhibitors fails to predict virologic response to combination therapy in children (PACTG 33." pptx
... in combination therapy responded favorably and rapidly. We did not observe an increase in the rate of viral failure after HAART linked to the presence of resistance muta- tions at baseline. In ... National Institute of Allergy and Infectious Dis- eases, National Institutes of Health, the Pediatric/Perinatal HIV Clinical Tri- als Network of the National Institute of Child...
Ngày tải lên: 10/08/2014, 05:20