Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx

Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

... Spier 4 Abstract Inhaled corticosteroids (ICSs) are the most effective anti-inflammatory agents available for the treatment of asthma and represent the mainstay of therapy for most patients with the ... significant improvements in the diagnosis and management of asthma over the past decade, as well as the availability of comprehensive and widely-accepted national and i...
Ngày tải lên : 08/08/2014, 21:20
  • 12
  • 774
  • 0
Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx

Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx

... one can study the electrical and metabolic activity of the outer layers of the retina. During the adaptation of the retina to dark, the amplitude of the EOG gradually decreases, reaching a nadir ... Fotiou 2 , Apostolos Iacovides 1 and George Kaprinis 1 Address: 1 Laboratory of Psychophysiology, 3rd Department of Psychiatry, Aristotle University of Thesssalo...
Ngày tải lên : 08/08/2014, 21:20
  • 10
  • 484
  • 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

... (pro)inflammatory mediators such as cytokines and matrix metalloproteinases [3]. Increased expression of inflammatory chemokines has been found in many inflammatory disorders, including hepatic ... chemokines play a role in inflammatory conditions by inducing integrin activation, chemotaxis, and angiogenesis. Apart from modulating migration directly, chemokines can stimulate cells to...
Ngày tải lên : 09/08/2014, 01:23
  • 5
  • 460
  • 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

... primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward ... GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAAT...
Ngày tải lên : 09/08/2014, 08:22
  • 10
  • 438
  • 0
Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx

Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx

... 5(4):557-572. 42. Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J: Gains, losses, and amplifications of genomic materials in primary ... relational database to store its source data. In particular, two different kinds of data are stored in two separate databases: genome annotation data (as availab...
Ngày tải lên : 10/08/2014, 09:22
  • 12
  • 455
  • 0
Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot

Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot

... features of early malignant melanoma on glabrous skin. A videomicroscopic analysis. Arch Dermatol 1998, 134:563-568. 46. Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa ... detection of plantar malignant melanoma. J Am Acad Dermatol 1990, 23:37-40. 44. Miyazaki A, Saida T, Koga H, Oguchi S, Suzuki T, T T: Anatomical and histopathological correlates of t...
Ngày tải lên : 10/08/2014, 21:23
  • 6
  • 413
  • 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

... group delay not only in the passband but also in the transition band. The mean value of the group delay ranges below that of linear-phase filters of the same length. The observed overall signal delay ... no tolerance 10 EURASIP Journal on Advances in Signal Processing and secondly using the fact that in case of real-valued signals the real part in frequency do...
Ngày tải lên : 21/06/2014, 19:20
  • 13
  • 623
  • 0
Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx

Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx

... they are very useful in the study of scattering the- ory and their power comes from the fact that they are representation independent; one may work either in the realspaceorintheFourierdualandcanmovefromone representation ... easy task. However, there is a clever way to extract information from this matrix without going into involved mathematical anal- ysis. The idea is t...
Ngày tải lên : 22/06/2014, 19:20
  • 10
  • 548
  • 0
Báo cáo y học: " Rectal microbicides: clinically relevant approach to the design of rectal specific placebo formulations." ppsx

Báo cáo y học: " Rectal microbicides: clinically relevant approach to the design of rectal specific placebo formulations." ppsx

... design, data analysis and drafting of the manuscript. All authors read and approved the final draft. Competing interests The authors declare that they have no competing interests. Received: 6 October ... evaluated using the MTT [1-(4,5-dimethylthiazol-2-yl)-3,5-diphenylfor- mazan] assay and histology. Rabbit Rectal Irritation Study A ten day repeat dose toxicology study in New Z...
Ngày tải lên : 10/08/2014, 05:22
  • 10
  • 731
  • 0
Báo cáo y học: "NPAS2 and PER2 are linked to risk factors of the metabolic syndrome" pps

Báo cáo y học: "NPAS2 and PER2 are linked to risk factors of the metabolic syndrome" pps

... taken and adapted from the Seasonal Pattern Assess- ment Questionnaire (SPAQ) [23]. The questionnaire was translated into Finnish and then back-translated to revise the linguistic accuracy. Each of ... gave a rationale for the current study. Methods This study was part of a nationwide health interview and examination survey, the Health 2000 Study, which was carried out i...
Ngày tải lên : 10/08/2014, 09:20
  • 9
  • 482
  • 0

Xem thêm