Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf
Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf
... amplified by two primer pairs (CCR5-F1:5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1:5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2:5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2:5'AAGCCATGTGCACAACTCTGACTG3') ... distribution of the genetic variants CCR5-Delta 32 and CD45-C77G in a cohort of Italian het-erosexually HIV-1 exposed and uninfected individuals.Our data suggest a partial protective effect of CCR5-Delta 32 ... signifi-cantly associated with lower rates of HIV-1 infectionamong white individuals. Marmor et al [16], analyzing a large sample of individuals, found a protective role of CCR5-Delta 32 allele in uninfected...
- 4
- 384
- 0
Báo cáo y học: "The protective effect of licofelone on experimental osteoarthritis is correlated with the downregulation of gene expression and protein synthesis of several major cartilage catabolic factors: MMP-13, cathepsin K and aggrecanase" docx
... Scientific,Nepean, ON, Canada), deparaffinized in xylene, rehydrated in a reverse-graded series of ethanol, and preincubated withchondroitinase ABC 0.25 units/ml (Sigma-Aldrich Canada,Oakville, ON, Canada) ... Lohmander LS, Neame PJ, Sandy JD: The structure of aggrecanfragments in human synovial fluid: Evidence that aggrecanasemediates cartilage degradation in inflammatory joint disease,joint injury, ... polyclonal goat antibody against collagenase-3 (MMP-13) (15 µg/ml; R&D Systems, Minneapolis, MN, USA); poly-clonal goat antibody against cathepsin K (1 µg/ml; Santa Cruz,Santa Cruz, CA, USA);...
- 12
- 1,188
- 0
Báo cáo y học: "QT interval prolongation related to psychoactive drug treatment: a comparison of monotherapy versus polytherapy" pdf
... ClinPsychopharmacology 2001, 21:8-13.5. Czekalla J, Kollack-Walker S, Beasley CM: Cardiac Safety param-eters of olanzapine: comparison with other atypical and typ-ical antipsychotics. J Clin ... and ana-lysed the results. CM ran the statistical analysis. AB and ECMean QTc (bars indicate standard deviations) values at base-line (T0) and after four days at full dosage (T1) of antipsy-chotic ... variability of measurements in precordial leads.Statistical Analysis A repeated measures analysis of variance was used to testthe effect of treatments on QTc (within subject factor:time of...
- 6
- 348
- 0
Báo cáo y học: "Extracellular mitochondrial DNA and oxidatively damaged DNA in synovial fluid of patients with rheumatoid arthritis" potx
... cellular damage in inflammatory loci,thus creating a vicious circle of inflammation and celldestruction and an increased release of endogenous, pro-inflammatory DNA. In the particular case of arthritis, ... con-centration of 4.0 mM MgCl2.PCR analysis of extracellular mtDNA in the clinicalsamplesThe results of a typical PCR analysis of plasma and SFsamples are shown in Fig. 1. Positive and negativesamples ... inflammation seen in mtDNA-injectedmouse joints. It is also worth emphasizing that the process of inflammation in RA joints is dynamic, with the infiltration of new inflammatory cells, the death...
- 7
- 308
- 0
Báo cáo y học: "Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice" pps
... GCAGAGAGGAGGTTGACTTTCIL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTGMCP-1 CCACTCACCTGCTGCTACTCAT TGGTGATCCTCTTGTAGCCCTCCCcl5 GTCGTGTTTGTCACTCGAAGGA TTGATGTATTCTTGAACCCACTTCTTiNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCGCOX-2 ... CATTGGAAGTGAAGCGTTTCGCOX-2 GTGGAAAAACCTCGTCCAGA GCTCGGCTTCCAGTATTGAGβ-Actin AGGTCATCACTATTGGCAACGA CACTTCATGATGGAATTGAATGTAGTTOpen AccessAvailable online http://arthritis-research.com/content/8/1/R14Page ... Santiago deCompostela.Collagen antibody-induced arthritis (CAIA) and clinical scoringCAIA was induced in 6-week-old male and female mice byintravenous injection on day 0 of 3 mg/mouse of...
- 9
- 270
- 0
Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx
... to that of the polyethyleneand polymethylmethacrylate particles. The bone, similar to thepolymeric materials, induced a granulomatous inflammatoryreaction. However, in contrast to the polymeric ... protein and bone sialoproteinshow marked changes during rat femoral head development.Matrix Biol 1995, 14:773-781.14. Sabokbar A, Fujikawa Y, Neale S, Murray DW, Athanasou NA:Human arthroplasty ... goat polyclonal antibody to human β3 integrin (sc-6627;Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). A rab-bit polyclonal antibody to human cathepsin K was kindly pro-vided by Dr D Bromme....
- 10
- 386
- 0
Báo cáo y học: " Traditional Indian medicine and homeopathy for HIV/AIDS: a review of the literature" docx
... of Ayurveda, Yoga-Naturopathy, Unani, Sid-dha and Homoeopathy (AYUSH), which is part of theMinistry of Health and Family Welfare. The mission of AYUSH includes: a) an initiative for integrating ... Deivanayagam CN, Krishnarajasekhar OR, Ravichandran N: Evalua-tion of Siddha medicare in HIV disease. J Assoc Physicians India2001, 49:390-391.7. Singh P, Yadav R, Pandey A: Utilization of indigenous ... transcriptase inhibitory activity. J Nat Prod1994, 57(7):896-904.52. Srikumar R, Parthasarathy NJ, Shankar EM, Manikandan S, Vijayaku-mar R, Thangaraj R, Vijayananth K, Sheeladevi R, Rao UA: Evaluationof...
- 9
- 517
- 0
Báo cáo y học: " Ethnoveterinary plant remedies used by Nu people in NW Yunnan of China" potx
... County,disease was a major factor causing animal mortality andconstraining the development of animal husbandry [9].The morbidity and death rates of animals in the threeNu villages was found ... diseases by dogsand other animals that come into contact with carcasses(Table 3). In recent years, with variable and unpredict-able temperature and rainfall, climate change has beenincreasingly ... fromhuman medicine sales points. In this situation, indigen-ous ethnoveterinary treatments play a very importantrole in farmers’ efforts to maintain animal health.Research has found that ethnoveterinary...
- 10
- 459
- 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTCCTCGACCAAAAAGATC; rcpA:forward,GCGATAGAATTCATGAGCGTAGAAACGGAAGAC and reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; cphB:forward,GCGATAGAATTCATG ACGAATTGCGATCGCGA ... domain of phytochrome-likeproteins of cyanobacteria (Calothrix sp. CphAand -B, Synechocystis sp. Cph1, and Anabaenasp. AphA and AphB, GenBank numbersAB028873 and AB034952), Arabidopsis thali-ana ... for cysteine,thus principally allowing covalent chromophore binding.Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTTCGCCGTGTCACATTGAATATTTGCACAATATGG-3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAATGTGACACGGCGAAACGCTGCGGAGTACCGAGTG-3¢....
- 10
- 499
- 0
Báo cáo y học: "Hospital Anxiety and Depression Scale (HADS): validation in a Greek general hospital sample" pdf
... Panayiota Michalopoulou†1, Georgia Kalemi†1, Katerina Fineti†1, Paulos Patapis†2, Konstantinos Protopapas†3 and Lefteris Lykouras*1Address: 1Second Department of Psychiatry, Athens ... co-designer of the studyand participated in data collection, KF participated in datacollection and processing, PP participated in data collec-tion and processing, KP participated in data collectionand ... Katerina Fineti - kfineti@yahoo.com; Paulos Patapis - gchclin@med.uoa.gr; Konstantinos Protopapas - kprotopapas@hotmail.com; Lefteris Lykouras* - panpsyclin@attikonhospital.gr* Corresponding author...
- 5
- 532
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ