Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

... citation purposes) AIDS Research and Therapy Open Access Short report Cytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation Lisa ... acid peptide incorporating 103N was recognized by patient T cells whereas the wild type was not. The RT K103N mutation is selected by the NNRTI...

Ngày tải lên: 10/08/2014, 05:20

... analysis of the gamma T- cell receptor rearrangement showed mono- clonality of the T cells, which raised the possibility of T- cell lymphoma. Infiltration by lymphocytes stained mostly for CD3 (T ... 20 kg during the preceding two months. The results of the physical examination and laboratory tests raised the possibility of neoplastic disease. A computerized t...

Ngày tải lên: 11/08/2014, 14:21

... the selection of the correct template and in the expected ®nal quality of the model. Other information, such as predicted and observed secondary structures of the target and template proteins, and ... known protein structures neither found any of these structures, nor highlighted any other statistically signi®cant homologies. The structures of the HERG and FixL P AS do...

Ngày tải lên: 24/03/2014, 00:21

... substantial contributions to conception and design, and to the analysis and interpretation of the data. TRM and GWC handled acquisition of data. All authors contributed to the manuscript revision ... comorbidity, the most common reason why patients met the effectiveness algorithm criteria but failed to meet the gold standard criteria was that the physician and patient we...

Ngày tải lên: 25/10/2012, 10:45

... importance for the structural integrity of the myosin head. An important role of the N-terminal region of the myosin head in the communication between the motor domain and regulatory domain can ... binding of the head to F-actin [19]. Therefore it can be suggested that actin-induced structural changes play an important role in the motor function of the myosin h...

Ngày tải lên: 17/03/2014, 10:20

... black staining was used to confirm protein presence and to detect bands not stained by the ruthenium red dye. Analysis of antifreeze activity Antifreeze activity was quantitated a s thermal hysteresis, which ... have enhanced binding to ice and this is not likely to be the case. This may be relevant to the calculation of smelt AFP activity. The activity of smelt AFP is about one-...

Ngày tải lên: 24/03/2014, 03:21

... sequence. The hydrolytic speci®city of the enzyme When the hydrolytic activities of the proteinase were measured at pH 9.0 with various synthetic substrates, the results listed in Table 5 were obtained. ... indicates that these peptides were probably separated by an autolytic e vent rather than by trypsin hydrolysis. In the subsequent discussion the peptides 3 and 4 are co...

Ngày tải lên: 31/03/2014, 21:21

... hospital [19]. The patients first present to the outpatient clerk who will direct all patients with musculoskeletal complaints to the orthopaedic outpatient department. The Research Ethics Committee ... patients seeing the doctor that day. After explaining the study in full and obtaining written informed consent, the research assistants administered the Urdu translation of...

Ngày tải lên: 08/08/2014, 23:21

... containing DHPC micelles To delineate the structural stability of the apoE-(72-166) peptides with or without DHPC, the GdnCl denaturation experiments were executed. The denaturation of the three ... the highest DMPC turbidity clearance ability. By fitting to biexponential decay model (Eq. 3), it suggested that the rate constants of apoE4- (72-166) in both phase were 4-13 t...

Ngày tải lên: 10/08/2014, 05:21

... copies of DR2 (ACGCTCACTGGAACACT GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG GAATGCCTCTAG) upstream of the thymidine-kinase promoter of reporter plasmid pUTK-Luc vector, ... Importantly, the interaction of SmNR1 ⁄ SmRXR1 is demonstrated by in vitro (GST pull-down assays) and in vivo (yeast two-hybrid and mammal cell assays) results. Likewise, the ab...

Ngày tải lên: 07/03/2014, 11:20