Báo cáo y học: "Scutellaria baicalensis decreases ritonavir-induced nausea." potx
Báo cáo y học: "compulsive disorder: a case report" potx
... response after an 'adequate treatment', as
defined by APA guidelines [8]. Additionally, in this partic-
ular patient, a history of poor clinical response to ade-
quate SSRI therapy, as well ... mainly due to a relatively low
prevalence and difficulty in detection of clinical features.
Therefore we have a lack of available data in the literature
for AA, especially for the most...
Báo cáo y học: "Isotretinoin and psychopathology: a review" potx
... Neary MP, Klaskala W, Strauss JS: Isotretinoin and
antidepressant pharmacotherapy: a prescription sequence
symmetry analysis. J Am Acad Dermatol 2003, 49:424-432.
31. Neary MP, Klaskala W, McLane ... 98:12320-12322.
55. Sakai Y, Crandall JE, Brodsky J, McCaffery P: 13-cis retinoic acid
(Accutane) suppresses hippocampal cell survival in mice. Ann
NY Acad Sci 2004, 1021:436-440.
56. Cranda...
Báo cáo y học: "Aggrecanases and cartilage matrix degradation" potx
... Design and synthesis of a series of (2R)-N(4)-
hydroxy-2-(3-hydroxybenzyl)-N(1)-[(1S,2R)-2-hydroxy-2,3-
dihydro-1H-inden-1-yl]butanediamide derivatives as potent,
selective, and orally bioavailable ... Number
061709 and NIH Grant AR40994.
References
1. Hinegård D, Lorenzo P, Sanxe T: Matrix glycoprotein, proteogly-
cans, and cartilage. In Kelly’s Textbook of Rheumatology. Edited
by...
Báo cáo y học: " Current status of lupus genetics" potx
... of lupus nephritis. Immu-
nity 1999, 11:131-139.
89. Gray-McGuire C, Moser KL, Gaffney PM, Kelly J, Yu H, Olson JM,
Jedrey CM, Jacobs KB, Kimberly RP, Neas BR, et al.: Genome
scan of human systemic ... Lee YH, Harley JB, Nath SK: CTLA-4 polymorphisms and sys-
temic lupus erythematosus (SLE): a meta-analysis. HumGenet
2005, 116:361-367.
46. Lee YH, Harley JB, Nath SK: Meta-analysis of...
Báo cáo y học: "Scutellaria baicalensis decreases ritonavir-induced nausea." potx
... rad-
ical-scavenging effect by electron spin resonance spec-
trometry [41]. They reported that in a hypoxanthine-
xanthine system, baicalein strongly reduced superoxide
radicals. Our laboratory has reported ... K, Yoshikawa Y,
Takada K: Drug interactions between HIV protease inhibitors
based on physiologically-based pharmacokinetic model. J
Pharm Sci 2002, 91:680-689.
28. Yamaji H, Matsumur...
Báo cáo y học: "Ischemic stroke destabilizes circadian rhythms" potx
... ischemic stroke on
circadian rhythm regulation, which is strongly linked to
sleep and mood, may thus potentially influence long-
term recovery in stroke patients.
In humans, the daily expression ... consistently affected in
this model of stroke. These results suggest that stroke may
unmask interactions between the parietal/CPu locomotor
rhythm generating system and other SCN-driven r...
Báo cáo y học: " (R)-albuterol decreases immune responses: role of activated T cells" docx
... TTGTGGAAGGGCTCATGACC (FW), TCTTCT-
GGGTGGCAGTGATG (RE) (NM008084), IL-2:
GTCAACAGCGCACCCACTT (FW), TGCTTCCGCTGTA-
GAGCTTG (RE) (NM008366), IL-6: TTCCATCCAGTT-
GCCTTCTTG (FW), GAAGGCCGTGGTTGTCACC (RE)
(NM008355), ... IL-13: AATCTGTCTGCAGGTGGGCT (FW),
GGCTTCTCACTTTCATTGGCAC (RE) (NM031168), IFN-
γ: AGGTGTCACAACTGCTGCCA (FW), ACACCCGAAT-
GAGCTGCTCT (RE) (NM008337). Direct detection of the
PCR...
Báo cáo y học: "Anaphylatoxin C3a receptors in asthma" potx
... healthy subjects.
Furthermore, deficiency in C3a generation or in G protein coupled receptor for C3a abrogates
allergen-induced responses in murine models of pulmonary inflammation and airway
hyperresponsiveness. ... generation. Chemokines and cytokines expressed
by ASM recruit and retain mast cells into the ASM layer
resulting in further smooth muscle dysfunction. T
H
2
cytoki...
Báo cáo y học: "Prokinetic agents in critical care" potx
... 5-HT
4
Motility Initiates peristaltic reflex by simultaneously activating ascending excitatory and
receptors on intrinsic stimulant descending inhibitory neural pathways
sensory neurones
5-HT, 5-hydroxytryptamine.
Table ... of
evidence by studying 40 patients randomly assigned to either
placebo or erythromycin 250 mg four times daily in 50 ml 5%
dextrose. Enteral feeding was commenced at 50...
Báo cáo y học: "Evidence-based medicine journal club" potx
... of the study valid?
Second, are the results clinically useful? Many young trainees
are frustrated with their early journal club experiences
because too often the more senior faculty focus on ... years and not previously
discussed in the journal club; the study must contain no
major flaws of methodology; and the results of the study, if
valid, must impact clinical practice in some way.
Aft...
Báo cáo y học: " The HTLV-1 Tax interactome" potx
... immortalization of T-
lymphocytes by HTLV-1 and plays a primary role in the
development of humoral hypercalcemia of malignancy
that occurs in the majority of patients with ATL [86,87].
Tax1 further associates ... Mechanistically, Tax1
enhances the dimerization of CREB/ATF factors, increases
their affinity for the viral CRE [33-36] and further stabi-
lizes the ternary complex th...
Báo cáo y học: "Chiropractic & Osteopathy. A new journal" potx
... journal changed its name to
Australasian Chiropractic & Osteopathy. It is this journal that
has changed from a print journal to the Open Access,
online journal Chiropractic & Osteopathy.
The ... simon.french@coca.com.au;
Melainie Cameron - melainie.cameron@coca.com.au
* Corresponding author
Abstract
Both chiropractic and osteopathy are over a century old. They are now regard...
Báo cáo y học: " Intravenous glutamine decreases lung and distal organ injury in an experimental model of abdominal sepsis" ppsx
... ultrastructural changes of lung parenchyma
and diaphragm; and c) lung and distal organ epithelial cell
apoptosis. Glutamine improved survival rate, oxygenation and
lung mechanics, minimized pulmonary and diaphragmatic
changes, ... efficacy at improving
oxygenation and lung mechanics, attenuating diaphragm and
distal organ injury has to be better elucidated....
Báo cáo y học: "Free radical theory of autoimmunity" potx
... Access
Research
Free radical theory of autoimmunity
Subburaj Kannan*
Address: DNA Repair & Drug Resistance Group, Departments of Microbiology and Immunology, School of Medicine, University of Texas Medical ... autoimmunity: a mitochondrial-lysosomal
axis theory. Med Hypotheses 2005, 64:1068.
145. Kannan S: Molecular basis of the drug resistance induced
autoimmunity: a redox...