Báo cáo y học: "Scutellaria baicalensis decreases ritonavir-induced nausea." potx

... response after an 'adequate treatment', as defined by APA guidelines [8]. Additionally, in this partic- ular patient, a history of poor clinical response to ade- quate SSRI therapy, as well ... mainly due to a relatively low prevalence and difficulty in detection of clinical features. Therefore we have a lack of available data in the literature for AA, especially for the most...

Ngày tải lên: 08/08/2014, 23:21

... Neary MP, Klaskala W, Strauss JS: Isotretinoin and antidepressant pharmacotherapy: a prescription sequence symmetry analysis. J Am Acad Dermatol 2003, 49:424-432. 31. Neary MP, Klaskala W, McLane ... 98:12320-12322. 55. Sakai Y, Crandall JE, Brodsky J, McCaffery P: 13-cis retinoic acid (Accutane) suppresses hippocampal cell survival in mice. Ann NY Acad Sci 2004, 1021:436-440. 56. Cranda...

Ngày tải lên: 08/08/2014, 23:21

... Design and synthesis of a series of (2R)-N(4)- hydroxy-2-(3-hydroxybenzyl)-N(1)-[(1S,2R)-2-hydroxy-2,3- dihydro-1H-inden-1-yl]butanediamide derivatives as potent, selective, and orally bioavailable ... Number 061709 and NIH Grant AR40994. References 1. Hinegård D, Lorenzo P, Sanxe T: Matrix glycoprotein, proteogly- cans, and cartilage. In Kelly’s Textbook of Rheumatology. Edited by...

Ngày tải lên: 09/08/2014, 01:21

... of lupus nephritis. Immu- nity 1999, 11:131-139. 89. Gray-McGuire C, Moser KL, Gaffney PM, Kelly J, Yu H, Olson JM, Jedrey CM, Jacobs KB, Kimberly RP, Neas BR, et al.: Genome scan of human systemic ... Lee YH, Harley JB, Nath SK: CTLA-4 polymorphisms and sys- temic lupus erythematosus (SLE): a meta-analysis. HumGenet 2005, 116:361-367. 46. Lee YH, Harley JB, Nath SK: Meta-analysis of...

Ngày tải lên: 09/08/2014, 10:20

... rad- ical-scavenging effect by electron spin resonance spec- trometry [41]. They reported that in a hypoxanthine- xanthine system, baicalein strongly reduced superoxide radicals. Our laboratory has reported ... K, Yoshikawa Y, Takada K: Drug interactions between HIV protease inhibitors based on physiologically-based pharmacokinetic model. J Pharm Sci 2002, 91:680-689. 28. Yamaji H, Matsumur...

Ngày tải lên: 10/08/2014, 05:20

... ischemic stroke on circadian rhythm regulation, which is strongly linked to sleep and mood, may thus potentially influence long- term recovery in stroke patients. In humans, the daily expression ... consistently affected in this model of stroke. These results suggest that stroke may unmask interactions between the parietal/CPu locomotor rhythm generating system and other SCN-driven r...

Ngày tải lên: 10/08/2014, 09:20

... TTGTGGAAGGGCTCATGACC (FW), TCTTCT- GGGTGGCAGTGATG (RE) (NM008084), IL-2: GTCAACAGCGCACCCACTT (FW), TGCTTCCGCTGTA- GAGCTTG (RE) (NM008366), IL-6: TTCCATCCAGTT- GCCTTCTTG (FW), GAAGGCCGTGGTTGTCACC (RE) (NM008355), ... IL-13: AATCTGTCTGCAGGTGGGCT (FW), GGCTTCTCACTTTCATTGGCAC (RE) (NM031168), IFN- γ: AGGTGTCACAACTGCTGCCA (FW), ACACCCGAAT- GAGCTGCTCT (RE) (NM008337). Direct detection of the PCR...

Ngày tải lên: 12/08/2014, 15:21

... healthy subjects. Furthermore, deficiency in C3a generation or in G protein coupled receptor for C3a abrogates allergen-induced responses in murine models of pulmonary inflammation and airway hyperresponsiveness. ... generation. Chemokines and cytokines expressed by ASM recruit and retain mast cells into the ASM layer resulting in further smooth muscle dysfunction. T H 2 cytoki...

Ngày tải lên: 12/08/2014, 18:21

... 5-HT 4 Motility Initiates peristaltic reflex by simultaneously activating ascending excitatory and receptors on intrinsic stimulant descending inhibitory neural pathways sensory neurones 5-HT, 5-hydroxytryptamine. Table ... of evidence by studying 40 patients randomly assigned to either placebo or erythromycin 250 mg four times daily in 50 ml 5% dextrose. Enteral feeding was commenced at 50...

Ngày tải lên: 12/08/2014, 19:21

... of the study valid? Second, are the results clinically useful? Many young trainees are frustrated with their early journal club experiences because too often the more senior faculty focus on ... years and not previously discussed in the journal club; the study must contain no major flaws of methodology; and the results of the study, if valid, must impact clinical practice in some way. Aft...

Ngày tải lên: 12/08/2014, 20:20

... immortalization of T- lymphocytes by HTLV-1 and plays a primary role in the development of humoral hypercalcemia of malignancy that occurs in the majority of patients with ATL [86,87]. Tax1 further associates ... Mechanistically, Tax1 enhances the dimerization of CREB/ATF factors, increases their affinity for the viral CRE [33-36] and further stabi- lizes the ternary complex th...

Ngày tải lên: 13/08/2014, 05:21

... journal changed its name to Australasian Chiropractic & Osteopathy. It is this journal that has changed from a print journal to the Open Access, online journal Chiropractic & Osteopathy. The ... simon.french@coca.com.au; Melainie Cameron - melainie.cameron@coca.com.au * Corresponding author Abstract Both chiropractic and osteopathy are over a century old. They are now regard...

Ngày tải lên: 13/08/2014, 13:22

... ultrastructural changes of lung parenchyma and diaphragm; and c) lung and distal organ epithelial cell apoptosis. Glutamine improved survival rate, oxygenation and lung mechanics, minimized pulmonary and diaphragmatic changes, ... efficacy at improving oxygenation and lung mechanics, attenuating diaphragm and distal organ injury has to be better elucidated....

Ngày tải lên: 13/08/2014, 16:20

Ngày tải lên: 13/08/2014, 19:20

... Access Research Free radical theory of autoimmunity Subburaj Kannan* Address: DNA Repair & Drug Resistance Group, Departments of Microbiology and Immunology, School of Medicine, University of Texas Medical ... autoimmunity: a mitochondrial-lysosomal axis theory. Med Hypotheses 2005, 64:1068. 145. Kannan S: Molecular basis of the drug resistance induced autoimmunity: a redox...

Ngày tải lên: 13/08/2014, 23:20