Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt

Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt

Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt

... non-transduced and trans- duced cells. Primers specific for CXCR4 (forward: 5'-ggag- gggatcagtatatacacttc and reverse: 5'-cgccaacatagaccaccttttc) and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc ... conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector Joseph Anderson and Ramesh Akkina* Address: Dept...

Ngày tải lên: 10/08/2014, 05:20

12 276 0
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"

Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"

... adducts that are capable of inducing muta- tions and initiating carcinogenesis. The capacity to repair DNA damage induced by activated carcinogens appears to be one of the host factors that may influ- ence ... NER and is involved in the DNA damage recognition process. Both RPA and XPA preferentially bind damaged DNA, and because RPA and XPA di- rectly interact in the absen...

Ngày tải lên: 31/10/2012, 14:59

13 712 0
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc

Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc

... only the novel data: protonation constants for DAHKam and VIHN, and stability constants (log a values) of Cu(II)-VIHN, Cu-DAHKam and Ni-DAHKam systems. The parameters of CD and EPR spectra of all major ... assessed by HPLC analysis of the final m aterials. I dentity and purity of peptide was confirmed by mass spectrometry, utilizing a Finnigan MAT TSQ 700 (Finnigan M...

Ngày tải lên: 22/02/2014, 04:20

9 630 0
Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

... development of a method for scor- ing these abnormalities [1]. A decade and a half ago additional data became available to validate the term 'disease modifying antirheumatic drugs' when sulphasalazine ... joints -of- interest. All 22 joints were also scored as repair by the panel. Repair was detected reliably by a majority of the panel on viewing paired images base...

Ngày tải lên: 09/08/2014, 10:20

9 374 0
Báo cáo y học: "Cerebrospinal fluid neopterin: an informative biomarker of central nervous system immune activation in HIV-1 infection" ppt

Báo cáo y học: "Cerebrospinal fluid neopterin: an informative biomarker of central nervous system immune activation in HIV-1 infection" ppt

... the development and widespread clinical use of quantitative assays of HIV-1 RNA that provided a valuable practical guide to the pace of disease progression and the effects of treatment. In parallel attention ... lumbar CSF. Neopterin appears to provide a more stable indicator of the aggregate mac- rophage activation in the CNS compartment. It is also easily and reliably...

Ngày tải lên: 10/08/2014, 05:21

12 321 0
Báo cáo y học: "Does carbon monoxide treatment alter cytokine levels after endotoxin infusion in pigs? A randomized controlled study" pptx

Báo cáo y học: "Does carbon monoxide treatment alter cytokine levels after endotoxin infusion in pigs? A randomized controlled study" pptx

... pigs also have similar cardiac anatomy and physiol- ogy as humans [16]. The endotoxin infusion model appeared to provide a highly stable and predictable circu- latory and pathophysiological state ... administered pigs, as evaluated by measured concentrations of plasma cytokines (TNF-alpha, IL-6, IL- 1beta and IL-10). The model was characterised by massive inflammation and a...

Ngày tải lên: 11/08/2014, 08:22

8 306 0
Báo cáo Y học: Variations in receptor site-3 on rat brain and insect sodium channels highlighted by binding of a funnel-web spider d-atracotoxin pdf

Báo cáo Y học: Variations in receptor site-3 on rat brain and insect sodium channels highlighted by binding of a funnel-web spider d-atracotoxin pdf

... d-ACTX-Hv 1a (Fig. 6). The positively charged Lys3, Lys4, Arg5, and Lys10 of d-ACTX-Hv 1a are oriented similarly to Lys8, Arg58, Lys62, and Arg18 of LqhaIT. The aromatic Trp7 and Tyr25 in d-ACTX-Hv 1a ... s ame amount of membranes. Data were analysed using the iterative program LIGAND (Elsevier B iosoft) u sing Ôcold saturationÕ or Ôhot saturationÕ analysis. The kinetic data fo...

Ngày tải lên: 08/03/2014, 16:20

11 538 0
Báo cáo Y học: Irregular spiking in free calcium concentration in single, human platelets Regulation by modulation of the inositol trisphosphate receptors ppt

Báo cáo Y học: Irregular spiking in free calcium concentration in single, human platelets Regulation by modulation of the inositol trisphosphate receptors ppt

... treatment of the platelets with aspirin and apyrase (blocking the effects of released thromboxane A 2 and ADP, r espectively) [35]. U sing plate- lets treated with a spirin and apyrase, we compared ... Histogram of variation in peak-to-peak interval of 15 responsive platelets. (D) Plot of total duration of individual peaks (90% decay) vs. peak amplitude. Data are mean va...

Ngày tải lên: 17/03/2014, 17:20

10 533 0
Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf

Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf

... Hoshina Y, Yamada C, Wakaba- yashi T, Jackson K, Inoko H: HLA class II haplotypes associated with pulmonary interstitial lesions of polymyositis/dermato- myositis in Japanese patients. Tissue Antigens ... Vazquez-Mellado J, Alcocer-Varela J, Sala- zar-Paramo M, et al.: Differences in idiopathic inflammatory myopathy phenotypes and genotypes between Mesoamerican Mestizos and North Ameri...

Ngày tải lên: 09/08/2014, 07:20

9 768 0
Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

... statistical analysis. J-PR contributed to study design, acquisition of data, analysis and interpretation of data, and sta- tistical analysis. M-JB and FA contributed to acquisition of data and ... severe lateral meniscal tear, and bone hypersignal in the lateral compartment at baseline, and WOMAC pain change. Meniscal damage and bone changes are the features most closely a...

Ngày tải lên: 09/08/2014, 10:20

11 518 0
w