Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
... frag- ment is expected. The following primers were used: 1, For- ward Tar: 5'-GCAATGATGTCGTAATTTGC and 2, Reverse Tar: 5'-CTTGCTCAGTAAGAATTTTCGTC. HIV-1 infection of thymocytes Thymocytes ... ideal environment for CD34+ cells to mature into thymocytes. To determine if the lentivirally expressed transgenes Tar and Tar- CCR5Rz would have any adverse effect on this d...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
... ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S100A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 ... TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACA...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... promoter activity. Further investigation is needed to elucidate the exact reason why the most distal MREa from transcription start site is important for activity, especially in a TATA-less promoter ... has the greatest effect on WD gene promoter activity. Several studies have reported that MREa in the promoter of the MT gene possesses transcriptional regulatory activity and that a variety...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
... substitutions can affect the cooperative nature of oxygen binding with heme, and in turn, can change the affinity of Hb for oxygen. The majority of mutations affecting oxygen affinity result ... evaluation of erythrocytosis, in double heterozygosity with another beta globin mutation [IVS-I-1(G->A)]. Her asymptomatic mother was found to be heterozygous for Hb Johnstown muta...
Ngày tải lên: 08/08/2014, 16:23
Báo cáo y học: "A 12 Week, Open Label, Phase I/IIa Study Using Apatone® for the Treatment of Prostate Cancer Patients Who Have Failed Standard Therapy" pps
... Following the 12 week trial, 15 of 17 patients opted to continue Apatone therapy. Any decision to remain on Apatone therapy was left entirely to the patient. Anecdotally, most patients reported ... Apatone therapy and end of therapy. (Æ) indicate where patients went off Apatone or started alternative therapy. Table 2. PSA Velocity and Doubling Time in Months PSA Velocity PSA...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: "Signalling pathway involved in nitric oxide synthase type II activation in chondrocytes: synergistic effect of leptin with interleukin-1" pdf
... properly cited. Abstract The objective of the present study was to investigate the effect of leptin, alone or in combination with IL-1, on nitric oxide synthase (NOS) type II activity in vitro in ... mature and hypertrophic ATDC5 chondrocytes, and in human primary chondrocytes. This study indicates that leptin plays a proinflammatory role, in synergy with IL-1, by inducing NOS type II...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Acute phase reactants add little to composite disease activity indices for rheumatoid arthritis: validation of a clinical activity score" potx
... calculation of the SDAI (and of the DAS28) is fre- quently limited at the time of the patient's visit either by a wait for laboratory results or their unavailability, omitting the APR from the ... unlimited and immediate assessment of disease activity by including only variables that are available by physical examination and patient questioning at the time of interaction w...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Polymorphism in the tumour necrosis factor receptor II gene is associated with circulating levels of soluble tumour necrosis factor receptors in rheumatoid arthritis" ppsx
... significant trend was found in levels of sTNF-RII released into culture medium by both unstimulated and stimulated T cells according to the TNF-RII genotype in the order TT > TG > GG (unstimu- lated ... identical trend in the release of sTNFRs, according to genotype, by isolated T cells from RA patients. We also demonstrated that the levels of sTNFR released by T ce...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Response to the commentary ‘Pooled indices to measure rheumatoid arthritis activity: a good reflection of the physician’s mind" pdf
... part of the investigation. It should be noted that the analysis we reported [2] was a post hoc analysis on a cohort of patients with rheumatoid arthritis (RA) who began infliximab therapy within ... like to clarify that the components of the American College of Rheumatology (ACR) core set response score and the Disease Activity Score (DAS28) were known to the treating physician, but...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Rheumatoid peripheral blood phagocytes are primed for activation but have impaired Fc-mediated generation of reactive oxygen specie" pptx
... and examined with a haemocytometer within 5 minutes of the addi- tion of the dye. In addition to trypan blue staining, the apoptotic state of cells was assessed by the determination of hypodip- loid ... to stimulation with fMLP was essentially identical to that with TNF-α incubation (data not shown). There were no statistical differences between stimulators or treat- ment groups a...
Ngày tải lên: 09/08/2014, 10:20