Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... mg/dl. Statistical analyses Data are presented as the mean ± standard deviation for vari- ables with a normal distribution, and as the median and inter- quartile range for variables with skewed distributions. Parametric ... green-top vacutainer tubes containing lithium- heparin as anticoagulant. Plasma CRP was also measured by immunoturbidimetry using the analyzer Cobas Integra (Roche D...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... unleashing NMDA and AMPA excitotoxic injury. Thus a mecha- nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR. Quantification of Vgf- and pro-SAAS-derived pep- tides in endocrine tissues and the brain, and their regulation by...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc
... 4. Yeast two-hybrid assay. A plate containing SD media minus leucin, t ryp tophan and histidine was seeded with yeast c arrying DNA- BD-Dys-1 and various AD-Dyb-1 p lasmids or empty pACT2 (as a negative ... their mammalian counterparts [12], and they also bind to syntrophin [18]. dys-1 and dyb-1 mutants d isplay a similar behavioural phenotype c onsisting of hyperactivity, exagg...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Implications of the simultaneous occurrence of hepatic glycolysis from glucose and gluconeogenesis from glycerol pdf
... glycolysis; metabolic channelling. The mammalian liver has the capability for both glycolysis and gluconeogenesis. In the fed state , a major fate o f glucose is glycolysis to py ruvate and l actate ... Biochemistry, 2 Anatomy and Histology and 3 Human Physiology, School of Medicine, The Flinders University of South Australia, Adelaide, South Australia, Australia Glycolysis from...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "Risk factors predict post-traumatic stress disorder differently in men and women" ppt
... explosion study was a devastating industrial accident, whereas the stab- bing incident was an intentional, interpersonal assault. The latter trauma types usually results in a higher preva- lence of ... be particularly relevant when studying NA because this is hypothesised to be a personality factor. It can be argued Annals of General Psychiatry 2008, 7:24 http://www.annals-general-p...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc
... primers Ang-1 GCC ATT ACC AGT CAG AGG CAG T CAT GCT AAG AAT TGA GTT AAT AAT AGG CTC GGT TCC CTT CC Ang-2 CGC TCG AAT ACG ATG ACT CG TGC AGA GGC TGC AAG TGC TGG AGA A CCA CTG AGT GTT GTT TTC CAT GAT Tie1 ... synovial tissue in comparison to OA and normal. In accordance with the staining data, RA synovial tissue demonstrated significantly higher Ang-1 mRNA expression compared to OA and...
Ngày tải lên: 09/08/2014, 03:24
Báo cáo y học: "IL-23 induces human osteoclastogenesis via IL-17 in vitro, and anti-IL-23 antibody attenuates collagen-induced arthritis in rats" ppt
... indicating that IL-23 is necessary to induce inflammation and osteoclastogenesis even after the onset of clinical arthritis. Staining of synovial tissues with hematoxylin and eosin showed that ... rats. After radiography, paraffin sections were prepared for histological analysis. Statistical analysis Data were analyzed with the Mann–Whitney U test, Student's t test, and Welch&apo...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "The shunt from the cyclooxygenase to lipoxygenase pathway in human osteoarthritic subchondral osteoblasts is linked with a variable expression of the 5-lipoxygenase-activating protein" doc
... ATG TAC CC-3' (sense) and 5'-GAC ATC TAT CAG TGG TCG TG-3' (antisense), and 5'-AAT GGG AGG AGC TTC CAG AG-3' (sense) and 5'-ACC AAC CCC ATA TTC AGC AG-3' (antisense). ... phos- phatase activity and osteocalcin release. Alkaline phosphatase activity was determined on cell aliquots by substrate hydrolysis with p-nitrophenyl phosphate, and osteocalcin...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... Sissel Grønlien, and Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund. ... possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, Resuscitation and...
Ngày tải lên: 25/10/2012, 09:56