Báo cáo y học: "Exome sequencing identifies a novel missense variant in RRM2B associated with autosomal recessive progressive external ophthalmoplegia" docx
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc
... SDS/ polyacrylamide gels. Radiolabeled proteins were visual- ized by phosphorimaging using a PhosphorImager 473 (Molecular Dynamics). In vivo membrane-targeting assay Membrane targeting of leader ... anti- bodies directed against leader peptidase and analysis by SDS/PAGE and autoradiography. Proteinase K-accessibility experiments Cells of prlA4 mutant strain NT1004, carrying plasmid pNN8,...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase docx
... enzyme bound flavin was assessed fluorimetrically by treating with phos- phodiesterase the flavin released after thermal denaturation at 100 °C of the holoenzyme [13]. Activity assays Enzyme catalyzed ... 6-phosphate dehydro- genase. Steady-state kinetic parameters for the diaphorase activities and for the cytochrome c reductase activity with mycobacterial ferredoxin were determined by varyi...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx
... is probably the translational start site because it is followed by a typical signal peptide motif with a basic residue (lysine) and a hydrophobic region (rich in valine and alanine) and matches ... three domains: a signal peptide (24 amino acids), prodomain (40 amino acids) andamaturepeptide(21aminoacids).Thegenehastwo introns and three exons. A TATA box and several consen- sus-...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... human fetal liver pAct2 cDNA library, containing coding sequences that are in frame with a GAL4 activation domain (Clontech), was screened with full-length hspry4 in pMD4 as bait. Yeast strain ... transcript without any substantial open reading frame. The longest transcript (7 kb) harbors five polyadenylation sites (two AATAAA, and three AATTAAA), nine ATTTA sequences [23], two Alu-r...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
... following a normal pregnancy and delivery, and had a history of delay in all areas of her development; she walked late, talked late (age 3) and found mainstream schooling very challenging. follow-up ... courses in managing the child’s behaviour and psychoeducational materials are made available. When pharmacological therapy is recommended, the various types of medication availabl...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient" pptx
... study support our hypothesis and indicate that certain HLA class II alleles, genotypes and haplo- types are associated with risk for or protection against RHD and that these associations are ... 100,000 children. Since then the course of RF has also changed; cur- rently, the inflammation of cardiac valves is accompanied by Sydenham's chorea, but without laboratory activity of inflam-...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... Hex 4 Æ Hep 4 ÆPEtn 2)3 ÆP 1 ÆKdoÆLipid A- OH, respectively. Characterization of OS Core OS material was obtained after partial acid hydrolysis of LPS with dilute aqueous acetic acid. The OS material was repeatedly chromatographed ... both in encapsulated (types a f) and unencapsulated (nontypeable) forms. While the incidence of disease caused by H. in uenzae type b (invasive diseases,...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo y học: "Fat-Storing Multilocular Cells Expressing CCR5 Increase in the Thymus with Advancing Age: Potential Role for CCR5 Ligands on the Differentiation and Migration of Preadipocytes" pot
... ligands mRNA expression increased in the aging thymus. The CCR5 ligands, CCL4 and CCL5, increase in the thymic parenchyma as revealed by the age -associated increases in the staining of thymocytes ... 18 and 21 months of age were mounted in a tissue array as previously described (19). For hematoxylin and eosin staining, sections were deparaffinized in xylene, re-hydrated...
Ngày tải lên: 08/08/2014, 18:20
Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx
... those with HCV-related arthropathy has great relevance in clinical practice. In fact, in contrast with RA, RA-like HCV-related arthropathy usually shows a relatively benign course that is not associated ... a monoarticular–oligoarticular intermittent arthritis affecting large and medium-sized joints and almost invariably asso- ciated with the presence of mixed cryoglobulinae...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot
... 3¢) SaOP1-F01 CGCTCCAGCCGCTGAACTCCTGAAGC SaOP2-F02 CCACCCCTCAGCCCATCGACCCTACC SaOP3-F03 GGCGGGACCTGACACCACCACTGACA SaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGG SaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV ... AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAA SaRPL2 7a- FW AAGAGGAACACAACTCACTGCCCCAC SaRPL2 7a- RV GCTTGCCTTTGCCCAGAACTTTGTAG Fig. 1. SaOP-L full-length cDN...
Ngày tải lên: 23/03/2014, 07:20