Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... IETD-CHO, N-acetyl-Ile-Glu-Thr-Asp-aldehyde; IETD-AMC, N-acetyl-Ile-Glu- Thr-Asp-AMC; LEHD-AMC, N-acetyl-Leu-Glu-His-Asp-AMC; YVAD-AMC, N-acetyl-Tyr-Val-Ala-Asp-AMC; z-VAD-fmk, ben- zoyloxycarbonyl-Val-Ala-Asp(OMe) fluoromethylketone. (Received ... KIPase activity in the indicated cell lines was assessed using the same assay. The data are expressed relative to the activity measured in the...
Ngày tải lên: 19/02/2014, 13:20
Báo cáo y học: "Deficiency of functional mannose-binding lectin is not associated with infections in patients with systemic lupus erythematosu" pptx
... these subanalyses, C4 deposition assay and MBL pathway activity assay were not associated with infections or major infections, either in univariate and mul- tiple regression analyses (data not shown). When ... Complement activation mediated by mannan- binding lectin in plasma from healthy individuals and from patients with SLE, Crohn's disease and colorectal cancer. Sup- presse...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Association of cerebrospinal fluid anti-ribosomal P protein antibodies with diffuse psychiatric/neuropsychological syndromes in systemic lupus erythematosus" pps
... Hirohata 1 , Yoshiyuki Arinuma 2 , Maki Takayama 2 and Taku Yoshio 3 1 Department of Rheumatology and Infectious Disease, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara, Kanagawa 228-8555, ... lupus erythematosus. Nat Med 2001, 7:1189-1193. 24. Karassa FB, Afeltra A, Ambrozic A, Chang DM, De Keyser F, Doria A, Galeazzi M, Hirohata S, Hoffman IE, Inanc M, et al.: Accur...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... well as molecular characteristics were similar in T-LGL leukemia patients with and without arthritis. aCL = anticardiolipin antibody; ANA = antinuclear antibody; ARA = American Rheumatism Association; ... dissem- inated intravascular coagulation, and myocardial infarction. An autopsy was not performed but death most probably was related to T-LGL leukemia -associated neutropenia. Patient...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
... TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA MYBPH AGGCCTACAGTCAAACTCCAGAGA ... ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRP...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"
... provide a Abstract Medical practitioners have a duty to maintain a certain standard of care in providing their services. With critical care ultrasound gaining popularity in the ICU, it is envisaged ... because the management plan adopted by the GP was appropriate [25]. Similarly, in Holliday v Curtin, a GP was held not liable for failure to diagnose breast cancer on a...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... objective was to gain insight into the care and management of patients with muscu- loskeletal chest pain as experienced by both those with chiropractic training, medical training or combined train- ing. Methods Data ... Bing ML, Abel RL, Sabharwal K, McCauley C, Zaldivar K: Imple- menting a clinical pathway for the treatment of Medicare patients with cardiac chest pain. Best Pract Ben...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"
... location in spine, Cysticercosis has been classified anatomically as extraspinal (vertebral) or intraspinal (epidural, subdural, arachnoid, or intramedullary), of which the intramedullary type is ... pain, paraparesis, spasticity, bowel and bladder in- continence, and sexual dysfunction 1,20 . However, in- flammatory reaction against the dead parasite is as- sociated with periles...
Ngày tải lên: 25/10/2012, 10:56
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Research Paper The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy 1 , Cenk Aypak 2 , Alpay Azap 1 , ... resistance patterns of leading nosocomial pathogens. Materials and Methods Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central...
Ngày tải lên: 25/10/2012, 11:00
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"
... stratified analysis ac- cording to ethnicity (Asian and Mixed/ Caucasian group). As shown in the Table 4, we found that the increased esophageal cancer risk associated with p53 Arg72Pro polymorphism ... Benhamou S, Bouchardy C, Kjaerheim K, Lowry R, Agudo A, Castellsague X, Conway DI, McKinney PA, Znaor A, McCartan BE, Healy CM, Marron M, Brennan P: Genetic associations of 115 p...
Ngày tải lên: 25/10/2012, 11:40