Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

... Access FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data Andrea Sboner 1,2† , Lukas Habegger 1† , Dorothee Pflueger 3 , Stephane Terry 3 , David ... of each pri- mer (forward, TMPRSS2 exon 1 - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon 5 - GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al. [23]) and 50 ng cDNA at...

Ngày tải lên: 09/08/2014, 22:23

... L, Zhang L, Bertucci AM, Pope RM, Datta SK: Apigenin, a die- tary flavonoid, sensitizes human T cells for activation-induced cell death by inhibiting PKB/Akt and NF-kappaB activation pathway. Immunol ... and participated in its design and coordination, data analysis, and manuscript preparation. All authors read and approved the final manuscript. Acknowledgements This work was supported...

Ngày tải lên: 09/08/2014, 14:20

... inadequate because substantial renal tissue damage can occur before function is impaired to a detectable extent [4]. Renal biopsy remains the gold standard for assessment of LN disease activity. ... injury has anti- inflammatory effects [5]. In the current paper by Schwartz and colleagues, TWEAK was assessed as a biomarker for LN in both cross-sectional and longitudinal studies. In...

Ngày tải lên: 09/08/2014, 14:22

... biochemical pathway (for sulfur metabolism) that may potentially be important for nasopharyngeal colonization. Conclusions: By improving our capacity to understand gene function in an important human pathogen, ... chromosomal inversions (Additional data file 1). To achieve an annotation as accurate as possible, we anno- tated 8013's genome manually by taking advantage of all the...

Ngày tải lên: 09/08/2014, 20:20

... S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick ... computational analysis. WS and DH analyzed the data. WS, DH and ML wrote the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank Benjamin Haley for sharing ....

Ngày tải lên: 09/08/2014, 20:21

... of 13 are examples of metadata) - to repeat an analysis exactly. When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step. Galaxy’s metadata includes ... computational biology experiment. Galaxy provides a framework for perform- ing computational analyses, systematically repeating ana- lyses, capturing all details of performed analyse...

Ngày tải lên: 09/08/2014, 20:22

... be an airway event. 17-alpha-alkylated anabolic androgens Attenuated androgens such as Danazol and Stanozolol are the usual agents with methyltestosterone and Bowen et al . Allergy, Asthma & ... University of Toronto, Oakville, Ontario, Canada. 21 Ancaster, Ontario, Canada. 22 St. Catharines, Ontario, Canada; Member and Chair, Patient Advisory Committee, Canadian Hereditary Angioedema Net...

Ngày tải lên: 08/08/2014, 21:20

... surgeries for many of these patients and drafted the manuscript. IS acquired the data. IA analysed the data and performed the statistical analyses. YI performed linguistic and technical correc- tions. ... the initial evaluation. Ten of these were vascular injuries that mostly affected the axillary and bra- chial arteries. In one case, the axillary artery was lacerated at the proximal repair...

Ngày tải lên: 10/08/2014, 10:20

... Access ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data Brad A Friedman 1,2,3* and Tom Maniatis 4 Abstract RNA-Seq and microarray platforms have ... Barres Lab (Stanford), Myers Lab (HudsonAlpha Institute), Ravits Lab (Benaroya Institute) and Maniatis Lab (Harvard/Columbia) for providing data and/or user feedback. This work was supp...

Ngày tải lên: 09/08/2014, 23:20

... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin....

Ngày tải lên: 03/11/2012, 11:52