Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf
... AccessFusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing dataAndrea Sboner1,2†, Lukas Habegger1†, Dorothee Pflueger3, Stephane Terry3, David ... of each pri-mer (forward, TMPRSS2 exon 1 - TAGGCGCGAGCTAAGCAGGAG; reverse, ERG exon 5 -GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al. [23]) and 50 ng cDNA at an annealingtemperature ... transcription factor genes in prostate cancer. Science 2005,310:644-648.24. Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S,Watanabe H, Kurashina K, Hatanaka H, Bando...
- 19
- 519
- 0
Báo cáo y học: "Apigenin, a non-mutagenic dietary flavonoid, suppresses lupus by inhibiting autoantigen presentation for expansion of autoreactive Th1 and Th17 cells" potx
... L, Zhang L, Bertucci AM, Pope RM, Datta SK: Apigenin, a die-tary flavonoid, sensitizes human T cells for activation-inducedcell death by inhibiting PKB/Akt and NF-kappaB activationpathway. Immunol ... andparticipated in its design and coordination, data analysis, andmanuscript preparation. All authors read and approved thefinal manuscript.AcknowledgementsThis work was supported by grants ... interests.Authors' contributionsH-KK participated in study design, apigenin therapy, cellularimmunologic assays, acquisition of data, statistical analysis,and drafting of the manuscript. DE measured...
- 13
- 287
- 0
Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot
... inadequate becausesubstantial renal tissue damage can occur before function isimpaired to a detectable extent [4]. Renal biopsy remains thegold standard for assessment of LN disease activity. ... injury has anti-inflammatory effects [5].In the current paper by Schwartz and colleagues, TWEAKwas assessed as a biomarker for LN in both cross-sectionaland longitudinal studies. In the former, ... sensitivity and specificity. In the previous issue of ArthritisResearch & Therapy, Schwartz and colleagues demonstrated thepotential value of urinary TNF-like weak inducer of apoptosis(uTWEAK) as...
- 3
- 337
- 0
Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot
... biochemical pathway (for sulfur metabolism) that may potentially be important for nasopharyngeal colonization.Conclusions: By improving our capacity to understand gene function in an important humanpathogen, ... chromosomal inversions (Additional data file 1).To achieve an annotation as accurate as possible, we anno-tated 8013's genome manually by taking advantage of all thefunctionalities of ... graphicalinterface (MaGe) for data visualization and exploration; andthe large Prokaryotic Genome DataBase (PkDGB) for datastorage, which contains more than 400 microbial genomes.We devoted particular care...
- 13
- 552
- 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx
... S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick ... computational analysis. WS and DH analyzed thedata. WS, DH and ML wrote the manuscript. All authors read and approved thefinal manuscript.AcknowledgementsWe thank Benjamin Haley for sharing ... apparent false negative rate of approxi-mately 5% and a false discovery rate of approximately19%.To systematically compare the miRTRAP and miRDeepmethods, we tested the new Ciona library data using...
- 12
- 552
- 0
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... of 13are examples of metadata) - to repeat an analysisexactly. When a user performs an analysis using Galaxy,it automatically generates metadata for each analysisstep. Galaxy’s metadata includes ... computational biologyexperiment. Galaxy provides a framework for perform-ing computational analyses, systematically repeating ana-lyses, capturing all details of performed analyses, andannotating ... selected by the user. Thehistory panel shows data and the results of analyses performed by the user, as well as automatically tracked metadata and user-generatedannotations. Every action by the...
- 13
- 400
- 0
Báo cáo y học: "2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema" pdf
... be an airway event.17-alpha-alkylated anabolic androgensAttenuated androgens such as Danazol and Stanozololare the usual agents with methyltestosterone andBowen et al . Allergy, Asthma & ... University of Toronto, Oakville,Ontario, Canada.21Ancaster, Ontario, Canada.22St. Catharines, Ontario,Canada; Member and Chair, Patient Advisory Committee, CanadianHereditary Angioedema Network ... theCanadian Hereditary Angioedema Network (CHAEN)/Réseau Ca nadien d’angioédème héréditaire (RCAH)http://www.haecanada.com and cosponsors University ofCalgary and the Canadian Society of Allergy...
- 13
- 718
- 0
Báo cáo y học: "Surgical outcomes of the brachial plexus lesions caused by gunshot wounds in adults" pdf
... surgeries for many ofthese patients and drafted the manuscript. IS acquired thedata. IA analysed the data and performed the statisticalanalyses. YI performed linguistic and technical correc-tions. ... the initial evaluation. Ten of these werevascular injuries that mostly affected the axillary and bra-chial arteries. In one case, the axillary artery was laceratedat the proximal repair line ... themean age was 22-years (ranging between 19 and 30years). One hundred and six patients had shrapnel injuryand 159 patients had bullet injury.Physical and Neurological evaluationThe physical...
- 10
- 355
- 0
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
... AccessExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression dataBrad A Friedman1,2,3*and Tom Maniatis4AbstractRNA-Seq and microarray platforms have ... Barres Lab (Stanford), Myers Lab (HudsonAlpha Institute), Ravits Lab(Benaroya Institute) and Maniatis Lab (Harvard/Columbia) for providing dataand/or user feedback. This work was supported by ... for gene expression analysis of RNA-Seq and microarray data.* Correspondence: brad.aaron.friedman@gmail.com1Department of Molecular and Cell Biology, Harvard University, 7 DivinityAve, Cambridge,...
- 12
- 394
- 0
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
... cardiovascular disease. In addition, data on food in-take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu-minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. Many recent ... Schoolweth AC, et al. Kidney disease as a risk factor for development of cardiovascular disease: a state-ment from the American Heart Association Councils on Kidney in Cardiovascular Disease, High...
- 5
- 723
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam