báo cáo khoa học: "Genetic variation of flesh colour in canthaxanthin fed rainbow trout" docx

báo cáo khoa học: "Genetic variation of flesh colour in canthaxanthin fed rainbow trout" docx

báo cáo khoa học: "Genetic variation of flesh colour in canthaxanthin fed rainbow trout" docx

... Genetic variation of flesh colour in canthaxanthin fed rainbow trout J.M. BLANC G. CHOUBERT I.N.R.A., Laboratoire d’Ecologie des Poissons et d’Aminagement des Pêches Centre ... families in experiment C were marked by fin-clipping 10 weeks prior to the beginning of the experimental feeding period, then placed together (1 200 individuals) in...

Ngày tải lên: 09/08/2014, 22:23

8 214 0
Báo cáo khoa học: "Genetic variation of the pilodyn-girth relationship in Norway spruce (Picea abies L [Karst])*" doc

Báo cáo khoa học: "Genetic variation of the pilodyn-girth relationship in Norway spruce (Picea abies L [Karst])*" doc

... error). Inbalances were taken into account by conduct- ing analysis using the type I sum of squares ana- lysis of variance (ANOVA) procedure of the MODLI software, an INRA ... genetic coefficient of variation in forestry. Can J For Res 24, 372-379 Cown DJ (1981) Use of the pilodyn wood tester for es- timating wood density in standing tr...

Ngày tải lên: 08/08/2014, 18:21

14 317 0
Báo cáo khoa học: "Genetic variation of the Croatian beech stands (Fagus sylvatica L): spatial differentiation in connection with the environment" doc

Báo cáo khoa học: "Genetic variation of the Croatian beech stands (Fagus sylvatica L): spatial differentiation in connection with the environment" doc

... al, 1987). In Croatia, in spite of the low poly- morphism of this locus, its allelic frequency Allelic differentiation according to associations The originality of Croatian ... characterized by the dominance of oak and mostly located below 500 m in altitude (only one of them located at 800 m was included in this group due to the drynes...

Ngày tải lên: 08/08/2014, 23:21

14 384 0
báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf

báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf

... expres- sion of g-TMT3 in the developing seeds of KAS lines was higher than in the seeds of Ichihime l ines. Conco- mitantly, g-TMT3 expression was higher in leaves of KAS than in those of Ichihime. ... using the inter- val mapping (IM) method provided in Map QTL 5.0 [19]. Markers flanking the QTLs were used as cofactors in QTL mapping by using the MQM method in the sa...

Ngày tải lên: 11/08/2014, 11:21

17 432 0
Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx

Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx

... of oak shake; some preliminary results. Silvae Genet 40, 166-168 Kleinschmit J (1986) Oak breeding in Germany; experiences and problems. In: Proceedings IUFRO Joint Meeting ... presence of longitudinal separations in the wood of liv- ing trees. Predisposition to shake in Quercus robur and Q petraea increases with the cross-sectional areas of...

Ngày tải lên: 08/08/2014, 19:21

4 287 0
Báo cáo khoa hoc:" Genetic polymorphism of milk proteins in African Bos taurus and Bos indicus populations" pdf

Báo cáo khoa hoc:" Genetic polymorphism of milk proteins in African Bos taurus and Bos indicus populations" pdf

... attention to the interesting features of the lactoprotein polymorphisms in Bos indicus, namely the predominance, at the a sl -casein locus, of the C allele, contrasting with the ... frequency of the B allele in Bos taurus, and the occurrence of a polymorphism of a-lactalbumin, contrasting with the monomorphism of this protein in the va...

Ngày tải lên: 09/08/2014, 18:21

15 410 0
Báo cáo khoa hoc:" Genetic parameters of dairy traits in the Alpine and Saanen goat breeds" pptx

Báo cáo khoa hoc:" Genetic parameters of dairy traits in the Alpine and Saanen goat breeds" pptx

... variability of dairy traits in goats, thus including both polygenic and major gene effects (asl-casein polymorphism, (l, 2!). The asl-casein polymorphism might explain part of the ... improve- ment of protein yield and protein content (PY and PC, respectively) because goat milk is mainly used for cheese production and protein content was a l...

Ngày tải lên: 09/08/2014, 18:21

6 300 0
Báo cáo sinh học: "Genetic variation of traits measured in several environments. I. Estimation and testing of homogeneous genetic and intra-class correlations between environments" ppt

Báo cáo sinh học: "Genetic variation of traits measured in several environments. I. Estimation and testing of homogeneous genetic and intra-class correlations between environments" ppt

... restreinte INTRODUCTION Hypothesis testing of genetic parameters is of great concern when analyzing genotype x environment interaction experiments. For instance, Visscher (1992) investigated ... above) is obtained by constraining the ratio(s) to be constant and finding the maximum under this constraint. The magnitude of the difference between the v...

Ngày tải lên: 09/08/2014, 18:21

13 417 0
Báo cáo sinh học: "Genetic variation of traits measured in several environments. II. Inference on between-environment homogeneity of intra-class correlations" pptx

Báo cáo sinh học: "Genetic variation of traits measured in several environments. II. Inference on between-environment homogeneity of intra-class correlations" pptx

... contribution to the problem of testing homo- geneity of intra-class correlations among environments in the case of univariate linear models, without making any assumption about ... extensively used in factor analysis of psychological data (Lawley and Maxwell, 1963). Original article Genetic variation of traits measured in several environment...

Ngày tải lên: 09/08/2014, 18:21

10 293 0
Báo cáo khoa học: "Genetic characterization of porcine circovirus - 2 field isolates from PMWS pigs" potx

Báo cáo khoa học: "Genetic characterization of porcine circovirus - 2 field isolates from PMWS pigs" potx

... G. Viral wasting syndrome of swine: Experimental reproduction of postweaning multi- systemic wasting syndrome in gnotobiotic swine by coinfection with porcine circovirus 2 and porcine parvovirus. ... strand F1 F2 R1 1768R 1696F 433R ACCAGCGCACTTCGGCAG TGAGTACCTTGTTGGAGAGC GTAATCCTCCGATAGAGAGC AATACTTACAGCGCACTTCTTTCG GGTGTCTTCTTCTGCGGTAACG TCCAACAAGGTACTCACAGCAG 18nt 20nt 20nt 24nt 22nt...

Ngày tải lên: 07/08/2014, 15:20

9 334 0
w