báo cáo khoa học: "Interactions géniteur x Il. Détection par des population des partenaires expériences de sélection" ppt

... M2 2, M3 7, M4 3, M5 6, M5 8, M5 9, AP72, AP73, AP74, AP76, AP77, AP79 ‡ 15% M1 , M2 , M4 , M5 , M6 , M9 , M1 2, M1 3, M1 5, M1 7, M1 8, M1 9, M2 3, M2 4, M2 5, M2 6, M2 7, M2 8, M2 9, M3 0, M3 1, M3 4, M3 6, M3 8, M3 9, M4 0, ... proteins bind glycosaminoglycans (Eur. J. Biochem. 270) 2305 Interactions between M proteins of Streptococcus pyog...

Ngày tải lên: 20/02/2014, 11:20

... coenzyme B 12 analogs and adenosylcobalamin-dependent glutamate mutase from Clostridium tetanomorphum Hao-Ping Chen 1 , Huei-Ju Hsu 1 , Fang-Ciao Hsu 1 , Chien-Chen Lai 2 and Chung-Hua Hsu 3 1 ... Taipei, Taiwan Glutamate mutase from Clostridium tetanomorphum is one of a group of adenosylcobalamin (AdoCbl)-depen- dent mutases that catalyzes the inter-conversion o...

Ngày tải lên: 07/03/2014, 04:20

... 2007) doi:10.1111/j.1742-4658.2007.05704.x The two forms of monoamine oxidase, monoamine oxidase A and mono- amine oxidase B, have been associated with imidazoline- binding sites (type 2). Imidazoline ligands saturate the imidazoline- binding ... Interactions of imidazoline ligands with the active site of purified monoamine oxidase A Tadeusz Z...

Ngày tải lên: 07/03/2014, 10:20

... Journal compilation ª 2007 FEBS MINIREVIEW Interactions between metals and a-synuclein ) function or artefact? David R. Brown Department of Biology and Biochemistry, University of Bath, UK Introduction Advances ... FE, Hewitt R, Ford KJ et al. (200 4) A strategy for designing inhibi- tors of alpha-synuclein aggregation and toxicity as a novel treatment for Parkinso...

Ngày tải lên: 07/03/2014, 10:20

... HeLa cells was similar (3.0 ± 1.1) to that A B C shifted 123 123456 band Probe 1.00E+008 AAAGAGATG AAGGACATG AAAGACCTG AAAGACATG K d =1.2 nM AAAGAGATG K d =0.29 nM AAAGACACG K d =4 nM AAAGACACG AAAGACATA AGAGACATG AAAGACATG AAAGCCATG AAATACATG 8.00E+007 6.00E+007 4.00E+007 2.00E+007 0.00E+000 14 16 12 10 8 Fluoriscence 340 Fluoriscence 340 6 4 0.00 ... mutants. ND, not determined. Sequence...

Ngày tải lên: 07/03/2014, 10:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 ... CCCGCTCGAGTCTTAGAATTATTGAGAACG 3 GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACA...

Ngày tải lên: 16/03/2014, 01:20

... posi- tion of the EF-P protein on the Escherichia coli 70S ribosome and its subunits. Binding of labeled EF-P to ribosomes To study the binding site of EF-P on ribosomes, we first ascertained that ribosomes ... deter- mined, as was the area of each peak. The ratio of the density, which is related to the amount of EF-P bound, to the area of the peak...

Ngày tải lên: 16/03/2014, 06:20

... increasing the binding affinity of the receptor for the synthetic ligand com- pared with the natural ligand. For example, in an effort to identify ligands that would distinguish between RARa and RARc, ... which the free ligand concentration is adjusted for the portion of ligand removed from solution by binding to the receptor [61]. K d for the interaction o...

Ngày tải lên: 16/03/2014, 12:20

... acts through the ligand binding pocket of USP to activate transcription of the DR1JHECore. Overexpression of EcR in the trans- fected cells results in the loading of the DR1 enhancer of the DR1JHECore ... ultraspiracle and ecdysone receptor in hormone signaling F. Fang et al. 1588 FEBS Journal 272 (2005) 15771589 ê 2005 FEBS Interactions of ultraspira...

Ngày tải lên: 23/03/2014, 13:20

... 2003 Thermodynamics of protein complex assembly (Eur. J. Biochem. 270) 4493 Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of ... Perham, R.N. (2002) Thermodynamic analysis of the binding of component enzymes in the assembly of the pyruvate dehydrogenase multienz...

Ngày tải lên: 30/03/2014, 20:20

... to the micromolar concentration of b-17. 1244 R. F. Epand et al.(Eur. J. Biochem. 270) Ó FEBS 2003 Interactions of the antimicrobial b-peptide b-17 with phospholipid vesicles differ from membrane ... that there are differences in the manner in which b-17 affects membrane properties, compared with magainin. One manifestation of these differences is the...

Ngày tải lên: 31/03/2014, 07:20

... que les autres sur des milieux stress s. Le but du présent travail est d’étudier l’effet du stress hydrique osmotique sur la germination des graines chez les provenances de Cèdre du Liban d’origine ... l’effet du stress hydrique osmotique sur la germination des graines chez les provenances de Cèdre du Liban. En utilisa...

Ngày tải lên: 08/08/2014, 14:22

... error rate of α = 0.05. Genet. Sel. Evol. 33 (2001) 231247 231 â INRA, EDP Sciences, 2001 Original article Power analysis of QTL detection in half-sib families using selective DNA pooling Jesús ... squares interval mapping of QTL based on selective DNA pooling, Proceedings of the 27th International Confer- ence on Animal Genetics ISAG2000, 22–26 July, Univer...

Ngày tải lên: 09/08/2014, 18:21

... Interactions géniteur x population des partenaires. I. Définition d’indicateurs. Ann. Génét. Sél. Anim., 14, 463-479. BRUN J.M., 1984. Interactions géniteur x population des partenaires. ... au niveau de chaque expérience n’est que rarement testée par les auteurs, on note Mise au point Interactions géniteur x population des partenaires...

Ngày tải lên: 09/08/2014, 22:22

... eu des Interactions géniteur x population des partenaires Il. Détection par des expériences de sélection J.M. BRUN LN.R.A., Station d’Amélioration génétique des Animaux, B.P. ... Castanet-Tolosan Résumé On examine l’intérêt des expériences de sélection pour l’étude des interactions entre les géniteurs d’une population Pa et la population...

Ngày tải lên: 09/08/2014, 22:23