báo cáo khoa học: "Microspatial differentiation of Drosophila melanogaster populations in and around a wine cellar in southern Spain Angeles ALONSO-MORAGA" pdf

báo cáo khoa học: "Microspatial differentiation of Drosophila melanogaster populations in and around a wine cellar in southern Spain Angeles ALONSO-MORAGA" pdf

báo cáo khoa học: "Microspatial differentiation of Drosophila melanogaster populations in and around a wine cellar in southern Spain Angeles ALONSO-MORAGA" pdf

... tolerance and Adh allozymes in natural populations of Drosophila melanogaster. Genet. Res., 36, 11-15. Microspatial differentiation of Drosophila melanogaster populations in and ... and around a wine cellar in southern Spain Angeles ALONSO-MORAGA A. MUÑOZ-SERRANO J.M. SERRADILLA J.R. DAVID * Universidad de Cordoba, Departamento de...

Ngày tải lên: 09/08/2014, 22:22

8 216 0
Báo cáo khoa học: Functional characterization of Drosophila melanogaster PERK eukaryotic initiation factor 2a (eIF2a) kinase pdf

Báo cáo khoa học: Functional characterization of Drosophila melanogaster PERK eukaryotic initiation factor 2a (eIF2a) kinase pdf

... The tRNA-binding moiety in GCN2 contains a dimeri- zation domain that interacts with the kinase domain and is required for tRNA binding and kinase activation. EMBO J. 20, 1425–1438. 48. Zhang, ... to rat PERK within the catalytic domain and its amino-terminal regulatory domain shares two unique structural features with mam- malian PERKs, a signal peptide and a transmembrane re...

Ngày tải lên: 31/03/2014, 07:20

14 296 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... sulfate. X-ray diffraction data of the wt and M100K crystals were collected on an in- house beam using a MAR345 Image Plate detector. The crystals were mounted in a capil- lary and datasets at ... Upon titrating increasing amounts of guanidinium hydrochloride (GdmHCl) the protein unfolds resulting in the perturbation of a number of electronic absorption bands and the...

Ngày tải lên: 07/03/2014, 17:20

15 510 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

... is the charge attraction between DNA phosphates and the amino groups of polyamines. As the amino groups of polyamines are already engaged in ionic bonds with the phosphates of NAPs, secondary amino ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applica...

Ngày tải lên: 23/03/2014, 15:20

11 380 0
Báo cáo khoa học: "mproving models of wood density by including genetic effects: A case study in Douglas-fir" potx

Báo cáo khoa học: "mproving models of wood density by including genetic effects: A case study in Douglas-fir" potx

... A genetic effect may affect the significance level of a model in at least two ways: either as a main factor, as in analysis of vari- ance (ANOVA), or within an interaction term when asso- ciated ... explaining ring density (D): ring width (W), ring cambial age (CA) and genetic identity (provenance P, family F, clone C). In one case (half-sib progeny), an additional geographi...

Ngày tải lên: 08/08/2014, 14:21

10 336 0
báo cáo khoa học: "Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast cancer patients" pot

báo cáo khoa học: "Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast cancer patients" pot

... this article as: Ravishankaran and Karunanithi: Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast cancer patients. World Journal of Surgical Oncology ... levels according to distant metastasis. (D) CRP levels according to TNM staging. Figure 4 Correlation between IL-6 and CRP in breast cancer. Ravishankaran and Karunanithi World J...

Ngày tải lên: 09/08/2014, 01:24

6 279 0
báo cáo khoa học: " The implications of trade liberalization for diet and health: a case study from Central America" ppt

báo cáo khoa học: " The implications of trade liberalization for diet and health: a case study from Central America" ppt

... Lanas F, Avezum A, Bautista LE, Diaz R, Luna M, Islam S, Yusuf S, INTERHEART Investigators in Latin America: Risk factors for acute myocardial infarction in Latin America: the INTER- HEART Latin ... from leading snack food companies like Diana in El Salvador and Señorial in Guatemala. In cookies, for example, local Imports of apples and grapes into Central America, 1990–2005*...

Ngày tải lên: 11/08/2014, 14:21

15 463 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

... the proinsulin seg- ment in between the B and A chains of insulin [1] and has an important structural role in the proper folding and disulfide bonding in insulin [2]. After proinsulin cleavage, ... formation of proinsulin C-peptide is affected by metals and insulin. Prosinsulin C-peptide oligomer formation as a function of time (A) . C-peptide was incu- bated for the in...

Ngày tải lên: 18/02/2014, 04:20

10 562 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... the attachment, capture and destruction of invading microorganisms. The NETs contain nuclear materials that include DNA and bactericidal proteins and histone-derived peptides such as buforins and ... 2). Comparison of the DNA gyrase inhibitory activity of HN with those of ciprofloxacin, LL-37 and amp- icillin (an antibiotic acting as an inhibitor of cell wall synthesis) ind...

Ngày tải lên: 18/02/2014, 14:20

12 756 0
Từ khóa:
w