báo cáo khoa học: "Chromosomal analysis of selected lines of Drosophila melanogaster with a new level of bristle canalization Eva" doc

... Chromosomal analysis of selected lines of Drosophila melanogaster with a new level of bristle canalization Eva GARC A- VÁZQUEZ J. RUBIO Departamento de Biologia Funcional (Area de ... widely studied as a model of canalized characters. Practically all the individuals of natural populations have the normal phenotype (fig. 1), although s...

Ngày tải lên: 09/08/2014, 22:22

... (Tyree et al, 1993) and for Acer saccharum and Populus deltoides (Tyree and Alexander, unpublished data). The leaf-blade resistance includes vascular and nonvascular pathways from ... if most water evaporation occurs near the stomata in accordance with the evidence in support of peristomatal evaporation in substomatal cavities (Tyree and Yianoulis, 1...

Ngày tải lên: 08/08/2014, 23:22

... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This project was supported by grants from the Aus- trian Science ... ACTIN2 gene as an internal standard. PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g...

Ngày tải lên: 14/02/2014, 19:20

... were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan). Culture and screening of bacteria Bacterial strains were cultivated for 15–20 h at ... a- oxobutyrate, fluoropyruvate, a- oxovalerate, a- oxoisocaproate, a- oxo-octanoate, and hydroxypyru- vate. However, branched-chain a- oxo acids, such as a- oxoisovalerate and a- oxo-b-met...

Ngày tải lên: 19/02/2014, 16:20

... Kitagawa-Sakakida S, Nishimura M, Morishita R, Kaneda Y, Kohmura E, Yoshimine T & Matsuda H (2001) Nuclear factor-kappa B decoy atten- uates neuronal damage after global brain ischemia: a future ... A requirement of nuclear factor-kappaB activation in fear- potentiated startle. J Biol Chem 277, 46720–46729. 39 Yeh SH, Lin CH & Gean PW (2004) Acetylation of nuclear factor-kappa...

Ngày tải lên: 07/03/2014, 03:20

... degradation, a semiquantitative RT-PCR evaluation was carried out on RNA isolated from control and transfected cells. The data showed comparable steady-state mRNA levels of uPA and c-met (Fig. 4A, B), ... trypsinized, and counted using a Burker chamber. Statistical analysis Each experiment was carried out at least twice. Histograms represent the mean values, and bars indicate standard...

Ngày tải lên: 29/03/2014, 23:20

... pre-sacral and then para-aortic nodes. Although majority of the nodes are located in internal iliac and external iliac areas, nodes have been found in also presacral, parametrial and parar- ectal ... patients with early stage cervical cancer. Gynecol Oncol 2003, 90:290-296. 50. Hubalewska A, Sowa-Staszczak A, Huszno B, Markocka A, Pityñski K, Basta A, Opławski M, Basta P: Use of Tc-...

Ngày tải lên: 09/08/2014, 07:21

... increasing concentrations of Chaps, higher concentrations of Chaps also abolished the enzymatic activity of RPE65. By careful titration, we found that Chaps at a concen- tration of 0.1% was optimal ... 5414–5418. 36 Bok D, Ruiz A, Yaron O, Jahng WJ, Ray A, Xue L & Rando RR (2003) Purification and characterization of a transmembrane domain-deleted form of lecithin retinol...

Ngày tải lên: 18/02/2014, 08:20

... ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG were used for trc amplification. The exact nucleotide sequence of each promoter region ... was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGAT- CCCGCGAAATTAATAC and TEHA8: ACACCCATGG- TATATCTCCTTCT, introducing restriction sites for PstI...

Ngày tải lên: 06/03/2014, 01:20

... type 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg ... type 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-G...

Ngày tải lên: 23/03/2014, 13:20