báo cáo khoa học: "Low frequency of inversion-carrying chromosomes in a population of Drosophila melanogaster from a cellar habitat" ppsx

... inversion-carrying chromosomes in a population of Drosophila melanogaster from a cellar habitat Ana GONZÁLEZ J.L. MÉNSUA Departamento de Geno!tica, Facultad de Ciencias Biol6gicas, Universidad ... of October 1979 simultaneous captures of Drosophila melanogaster were made in 2 relatively distinct habitats near Requena (Valencia-Spain) : a...

Ngày tải lên: 09/08/2014, 22:22

... nuclear antigen (PCNA), anti-p53, anti-p27, anti-p21 and anti-FGF-2, anti-α-tubulin antibodies were purchased from Santa Cruz Biotechnology (USA). The antibody against mammalian target of rapamycin ... the eventual molecular/cellular events in lung development. Akt is a serine/threonine kinase that is a crucial mediator in signaling pathways [3], and Akt signaling plays an i...

Ngày tải lên: 07/08/2014, 23:22

... full-sibs or half-sibs. At each generation (F8, F9, and F10) a representative sample of male chickens was rai- sed to 9 wk of age and slaughtered. Abdominal fat was measured. ... and live weights were not significant; analysis of variance (t test) was then used instead of analysis of covariance to compare lines. At hatching, FL chicks...

Ngày tải lên: 09/08/2014, 22:22

... in various organ systems. Even in organisms lacking a brain, such as Caenorhabditis elegans, the nervous system plays a key role in maintaining energy balance [1–4]. In more advanced, mammalian ... acetyl-CoA car- boxylase; AMPK, 5¢ AMP kinase; CPT, carnitine palmitoyltransfer- ase; FAS, fatty acid synthase; MCD, malonyl-CoA decarboxylase; OAA, oxaloacetate; TCA, tricarboxylic aci...

Ngày tải lên: 14/02/2014, 22:20

... Flodin A & Skalnik DG (2000) Cloning of a mammalian transcrip- tional activator that binds unmethylated CpG motifs and shares a CXXC domain with DNA methyltransfer- ase, human trithorax, and ... Laboratories, Burlingame, CA, USA), and studied by standard fluores- cence microscopy. Analysis of anaphases in embryonic fibroblasts To determine the occurrence of lagging chromosome...

Ngày tải lên: 07/03/2014, 21:20

... AATAAA HN 55 CCACACCATCAGGCTGTGGATACATAGATAAGGCAACATGG 95 TATAAA B H4g –66 CGCCTGTGGTCTTCAATCAGGTCCGCAGAAGGTCTATTTAAA )25 *CTTTT H4s –63 TCCCTGCTGTTTTCAAACAGGTCCGCTCCCAGGAAATATAAGC )21 *CTGTA H4-v.1 )80 CGCTCCCTGTTTTCACTCCGGTCCGCAAGTTCCATATAAGA )40 *GAGCA HN )72 CACTTGAAGTTCTCAACCAGGTCCGATAAGAGTGTATACTT -34 *TGGAA a Underlined ... Sequence characteristics Poly (A) signal c Cap site A H4g...

Ngày tải lên: 16/03/2014, 13:20

... that of CDX1 during the progression of intestinal metaplasia. J Gastroenterol 37, 94–100. 4 Satoh K, Mutoh H, Eda A, Yanaka I, Osawa H, Honda S, Kawata H, Kihira K & Sugano K (2002) Aberrant ... Gastric carcinoma spontaneously developed from intestinal metaplasia in all stomachs of Cdx2- transgenic mice examined [7]. In Barrett’s esophagus, normal squamous esopha- geal mucosa...

Ngày tải lên: 23/03/2014, 04:20

... to macro- phages [4]. Using a single radial enzyme diffusion method, Yasuda et al. [5,6] found that DNase II activity in the Japanese population can be classified into low-activity (DNASE2 L) and ... increase in luciferase activity was seen in the presence of increasing amounts of the pPacSp1 plasmid, and a similar, but much smaller, effect was seen using pPacUSp3. In contras...

Ngày tải lên: 23/03/2014, 17:21

... blot analysis of purified FAEES. Antibody (raised in rabbit) against FAEES was used to react with pure FAEES protein. Lane 1 shows no band (control lane). Rat albumin was used as control protein. ... ethanol and phosphate buffer for 60 min. At the end of the incubation interval, the reaction was terminated by the addition of 2 mL of cold acetone containing a known amount of ethyl...

Ngày tải lên: 30/03/2014, 11:20

... Currentissuesandconstrains Advantages of VAC coastline • Local materials and byproducts such as fertilizers, straw, grass are easily available and are cheap • Trash fish is still a cheap source of ... ResultsandDiscussion Assessment of currentstatus of integratedsystem in costalarea of theNorth CentralVietnam Speciesused in VAC(AquacultureandHorticulture) In Vi...

Ngày tải lên: 21/06/2014, 04:20