Báo cáo y học: "Transcription, one allele at a time" ppsx
Báo cáo y học: "Transcription, one allele at a time" ppsx
... in the case of the signaling pathway that activates the transcription factor NFκB [2]. Negative-feedback loops within the NFκB pathway generate cyclic subcellular accumulation of signaling proteins, ... elongation and finally termination [1]. Most of the players in these processes, such as the general transcription factors associated with the RNA polymerase, elongation factors, and termination ... integration of MS2-tagged gene constructs using tradi-tional techniques (such as plasmid integration or viral infection) has resulted in the integration at a random genomic location of an array...
- 4
- 254
- 0
Báo cáo y học: "Transcription profiling of rheumatic diseases" doc
... idiopathicarthritis [SoJIA], 94 paediatric infections, 38 paediatric SLE,six PAPA [a familial autoinflammatory disease that causespyogenic sterile arthritis, pyoderma gangrenosum and acne]and 39 healthy ... whichindicates that this pathway is also activated systemically inRA. This type I IFN signature may be a direct reflection ofincreased activity of type I IFN. However, it cannot beexcluded that another ... performingand publishing microarray studies, standards for microarrayexperiments and data analysis were created [1].Now, after a decade of technical and analytical improvement,the technology and algorithms...
- 13
- 335
- 0
Báo cáo y học: " Non-imprinted allele-specific DNA methylation on human autosomes" pptx
... hyper- methylatedAlways: del hyper- methylatedAlways: C hyper- methylated1 case: A hyper- methylated in left part of ampliconAverage allelic methylation difference in ASM cases53% 60% ... 8Individuals with SNP and ASM8719311Coupling of ASM and genotypeAlways: C hyper- methylatedAlways: C hyper- methylated18 cases: G hyper- methylated in right part of ampliconAlways: G hyper- ... bar represent the standard deviations of the data. This representation of the data clearly indicates that there is no age-related gain of methylation in this amplicon.00.20.40.60.8AA AG...
- 11
- 311
- 0
Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx
... E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H,Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T,Hattori M, Shinagawa H: Complete genome sequence ofenterohemorrhagic ... likelythat VSs are generated by replication slippage betweenthe repeats, a mechanism also called short-homology-dependent illegitimate recombination [65]. Although notas proportiona lly abundant ... in[85].MinisatellitesGenomes were searched for tandemly repeatedsequences on the minisatellite database of G Vergnaud’slaboratory [86]. Parameters used were repeat motifs at least 20 bp long, repeate...
- 15
- 424
- 0
Báo cáo y học: "Modulated contact frequencies at gene-rich loci support a statistical helix model for mammalian chromatin organizatio" ppsx
... RikenExpression Array Database [25], we identified 130mouse genes that display strong co-expression patternswith at least one other gene located less than 400 kbaway in cis (see Materials and methods) and ... statistical helix model predicts a linear polymerorganization (Additional file 7a) . However, data obtained in GC-richdomains are fully compatible with a statistical helix organization.Compared ... For 3C-qPCR analyses ofsite F-28 at Usp22 locus, a PCR product encompassing733bparoundsiteF-28wasgeneratedfromgenomicDNA (FA4 gccatactcagccacagggac and RA2 cctgatct-cacgaatcaccctc). This PCR...
- 13
- 238
- 0
Báo cáo y học: "Summary of presentations at the NIH/NIAID New Humanized Rodent Models 2007 Workshop" ppsx
... NA NA NAPre-transplant treatment-mice NA NA NAPre-transplant treatment-cells NA NA NATime frame from construction to experimental useimmediately Immediately immediatelyLocation of human ... HIV vaccines NA In progress (humoral immunity) NATreatment HIV vaccines NA NA NAAdoptive Anti-HIV Ig therapy NA NA NAAdoptive Anti-HIV CTL therapy NA NA NAImmunoadjuvent therapy NA NA NA ... permits thymocyte maturation in Rag- but notCD3gamma-deficient mice. J Exp Med 1999, 190(8):1059-1068.33. Ohbo K, Suda T, Hashiyama M, Mantani A, Ikebe M, Miyakawa K,Moriyama M, Nakamura M, Katsuki...
- 14
- 409
- 0
Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf
... databasesThe goals and features of the NFI-Regulome databaseappear unique among TF binding site databases. Thereare a number of databases that are significantly largerthantheNFI-RegulomeDatabaseasassessedbythenumber ... data-base and by taking advantage of the featu res provided bythe underlying database we define t hese constraints at the same time that the data and relationships are defined,freeing the application ... extract and u seinformation stored in genome databases, is an essentialpart of genomic and bioinformatic analysis [1-4]. Whilenow primarily a basic research tool, analysis of genomeannotation...
- 10
- 386
- 0
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"
... Endotracheal, umbilical or intracar-dial routes are poorer alternatives as regards speed ofinsertion and reliability in emergency resuscitation.Great saphenous vein cutdown as an emergency surgicalapproach ... Research Ethics but was sub-mitted there for evaluation, and they had no objectionsto the study or the results being published.Study data were collected in a separate research data-base. Rates ... that handle critically ill or injured paediatric and adult patients should be familiar withintraosseous techniques.BackgroundVascular access is important in the resuscitation of criti-cally...
- 5
- 559
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... recovery was une-ventful, and the patient was discharged on postoper-ative day 4. Fig.1 Fluid collection and left ovary cyst was noted on computed tomography. The size of ovary cyst was 2.0 ... invagination of diverticu-lum has an advantage over diverticulectomy in that it minimizes bowel leakage [15]. Moreover, invagina-tion of diverticulum can be easily performed using laparoscopy ... 1968;54(Suppl):778-80. 12. Lawson HH. Haemoperitoneum associated with a solitary diverticulum of the sigmoid colon. S Afr Med J. 1961;35:715-6. 13. Matsagas MI, Fatouros M, Koulouras B, Giannoukas AD. Incidence,...
- 3
- 531
- 0
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
... support as a treatment approach [5]. It is also noteworthy that in a study among primary health care teams only 4 out of 10 physicians were aware about the presence of an effec-tive treatment ... -logical sequelae and poor levels of psychosocial adaptation comparative to the general population [6]. There is limited information about psychological dis-tress that patients with lymphedema ... inability of the lymphatic system to maintain normal tissue homeostasis [1]. It may be classified as primary or secondary [1]. Primary lymphedema re-sults from congenital abnormality or dysfunction...
- 5
- 443
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ