Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx

Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx

Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx

... proportionally. Discussion Microdiversity constitutes a m ajor type of variability between bacterial genomes within a species Themainoutcomeofthisstudyisthediscoveryofa major type of bacterial genome diversity at the species level, ... Bioinformatics 2008, 9:498. 6. Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Mu...

Ngày tải lên: 09/08/2014, 20:21

15 424 0
Báo cáo y học: "Small GTP-binding protein Rho-mediated signaling promotes proliferation of rheumatoid synovial fibroblast" pot

Báo cáo y học: "Small GTP-binding protein Rho-mediated signaling promotes proliferation of rheumatoid synovial fibroblast" pot

... nonfat milk, and analyzed by western blotting using a polyclonal anti-Rho antibody. Statistical analysis Data are expressed as mean ± standard deviation (SD) of the number of indicated patients. ... cells. Introduction Rheumatoid arthritis (RA) is characterized by synovial pro- liferation, neovascularization, and accumulation of inflam- matory cells in inflamed joints. Synovial cell...

Ngày tải lên: 09/08/2014, 06:22

9 405 0
Báo cáo y học: " Small intestinal strictures as a complication of mesenteric vessel thrombosis: two case reports" doc

Báo cáo y học: " Small intestinal strictures as a complication of mesenteric vessel thrombosis: two case reports" doc

... patients, a Caucasian male aged 67 and a Caucasian female aged 78, the diagnosis was delayed because of the infrequency of their presentation. Both patients eventually underwent a resection of the ... by way of computed tomogra- phy scan and gastrointestinal endoscopy had shown this not to be the case and they were managed appropriately. The current literature on the...

Ngày tải lên: 11/08/2014, 14:20

4 358 0
Báo cáo y học: " Tropheryma whipplei tricuspid endocarditis: a case report and review of the literature" ppsx

Báo cáo y học: " Tropheryma whipplei tricuspid endocarditis: a case report and review of the literature" ppsx

... clear. Concerning treatment, our patient was initially treated by ceftriaxone then with a combination of sulfamethoxa- zole/trimethoprim, hydroxychloroquine and doxycycline for one year. By analogy ... loss of two years duration. Physical examination revealed a systolic murmur on the left sternal margin. The diagnosis of Whipple’ s disease was made on jejunal biopsy by electron...

Ngày tải lên: 11/08/2014, 07:20

4 397 0
Báo cáo sinh học: "15 kDa Granulysin versus GM-CSF for monocytes differentiation: analogies and differences at the transcriptome level" docx

Báo cáo sinh học: "15 kDa Granulysin versus GM-CSF for monocytes differentiation: analogies and differences at the transcriptome level" docx

... GM-CSF-treated monocytes clearly showed a unique down-regulation of the IL-10 Anti-Inflammatory Signaling and the Co-stimulatory Signal during T-cel l Activ ation Pathways, whereas Gran- ulysin-treated ... induced whereas, at later time points, lymphocyte proli feration genes and humoral immune response were up-regulated. In addition, the pathway analysis clearly demonstrated that...

Ngày tải lên: 18/06/2014, 19:20

12 388 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

... 12:R64 http://genomebiology.com/2011/12/7/R64 Page 5 of 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT ... small RNA. Our small RNA cloning strategy only captures small RNAs that are, as miRNAs , 5’-phospho rylated and, thus, eliminates RNA degr...

Ngày tải lên: 09/08/2014, 23:20

13 365 0
Báo cáo y học: "Small ruminant feed systems: perceptions and practices in the transitional zone of Ghan" docx

Báo cáo y học: "Small ruminant feed systems: perceptions and practices in the transitional zone of Ghan" docx

... calculate pre-weaning average daily gain (ADG) separately for male and female kids. Prolifi- cacy was calculated as the percentage of all kids dropped of all kidding. Mean ADG and prolificacy values ... surve y data was analysed with SPSS (ibid). Cross tabulation of feeds fed against the source, access by small ruminants, and seasonal availability was done to identify feed system...

Ngày tải lên: 10/08/2014, 09:21

15 493 0
Báo cáo y học: " Dual paraneoplastic syndromes in a patient with small cell lung cancer: a case report" pdf

Báo cáo y học: " Dual paraneoplastic syndromes in a patient with small cell lung cancer: a case report" pdf

... collected all of the patient data and wrote the initial draft of the manuscript. SW checked all of the data for accuracy and did considerable Table 1 Paraneoplastic syndromes associated with small ... syndrome 5% ACTH Hyponatremia of malignancy 15% AVP, CRH (rare) Hypertension <1% Renin Amenorrhea, galactorrhea <1% Prolactin, GH Hyperamylasemia <1% Salivary anylase La...

Ngày tải lên: 10/08/2014, 23:22

4 263 0
Báo cáo y học: "Bilateral optic neuritis in a 26-year-old man with common variable immunodeficiency: a case report" pot

Báo cáo y học: "Bilateral optic neuritis in a 26-year-old man with common variable immunodeficiency: a case report" pot

... Universitario de Alicante, Alicante, Spain. 2 Hematology Service, Hospital Marina Baixa, Villajoyosa, Spain. Authors’ contributions APS and MLT conceived the study and drafted the manuscript, SPD and AGP ... mg/day for five days) and a tapering course of oral prednisone. Two weeks later, his visual acuity was one in the right eye and 0.6 in the left eye. Our patient remained asymp...

Ngày tải lên: 10/08/2014, 23:22

2 304 1
w