Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx
Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx
... proportionally.
Discussion
Microdiversity constitutes a m ajor type of variability
between bacterial genomes within a species
Themainoutcomeofthisstudyisthediscoveryofa
major type of bacterial genome diversity at the species
level, ... Bioinformatics 2008, 9:498.
6. Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG,
Ohtsubo E, Nakayama K, Mu...
Báo cáo y học: "Small GTP-binding protein Rho-mediated signaling promotes proliferation of rheumatoid synovial fibroblast" pot
... nonfat milk, and analyzed by
western blotting using a polyclonal anti-Rho antibody.
Statistical analysis
Data are expressed as mean ± standard deviation (SD) of
the number of indicated patients. ... cells.
Introduction
Rheumatoid arthritis (RA) is characterized by synovial pro-
liferation, neovascularization, and accumulation of inflam-
matory cells in inflamed joints. Synovial cell...
Báo cáo y học: " Small intestinal strictures as a complication of mesenteric vessel thrombosis: two case reports" doc
... patients, a Caucasian male aged 67 and a Caucasian female aged 78, the diagnosis was delayed
because of the infrequency of their presentation. Both patients eventually underwent a resection of
the ... by way of computed tomogra-
phy scan and gastrointestinal endoscopy had shown this
not to be the case and they were managed appropriately.
The current literature on the...
Báo cáo y học: " Tropheryma whipplei tricuspid endocarditis: a case report and review of the literature" ppsx
... clear.
Concerning treatment, our patient was initially treated
by ceftriaxone then with a combination of sulfamethoxa-
zole/trimethoprim, hydroxychloroquine and doxycycline
for one year. By analogy ... loss of two years duration. Physical examination
revealed a systolic murmur on the left sternal margin.
The diagnosis of Whipple’ s disease was made on jejunal
biopsy by electron...
Báo cáo sinh học: "15 kDa Granulysin versus GM-CSF for monocytes differentiation: analogies and differences at the transcriptome level" docx
... GM-CSF-treated monocytes
clearly showed a unique down-regulation of the IL-10
Anti-Inflammatory Signaling and the Co-stimulatory
Signal during T-cel l Activ ation Pathways, whereas Gran-
ulysin-treated ... induced
whereas, at later time points, lymphocyte proli feration
genes and humoral immune response were up-regulated.
In addition, the pathway analysis clearly demonstrated
that...
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... 12:R64
http://genomebiology.com/2011/12/7/R64
Page 5 of 13
AD3.1
ND.1
AD8.2
AD3.2
ND.2
AD8.1
counts / million
ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT ... small
RNA. Our small RNA cloning strategy only captures
small RNAs that are, as miRNAs , 5’-phospho rylated and,
thus, eliminates RNA degr...
Báo cáo y học: "Small ruminant feed systems: perceptions and practices in the transitional zone of Ghan" docx
... calculate pre-weaning average daily
gain (ADG) separately for male and female kids. Prolifi-
cacy was calculated as the percentage of all kids
dropped of all kidding. Mean ADG and prolificacy
values ... surve y data was analysed with SPSS (ibid).
Cross tabulation of feeds fed against the source, access
by small ruminants, and seasonal availability was done
to identify feed system...
Báo cáo y học: " Dual paraneoplastic syndromes in a patient with small cell lung cancer: a case report" pdf
... collected all of the patient data and wrote the initial draft of the
manuscript. SW checked all of the data for accuracy and did considerable
Table 1 Paraneoplastic syndromes associated with small ... syndrome 5% ACTH
Hyponatremia of malignancy 15% AVP, CRH (rare)
Hypertension <1% Renin
Amenorrhea, galactorrhea <1% Prolactin, GH
Hyperamylasemia <1% Salivary anylase
La...
Báo cáo y học: "Bilateral optic neuritis in a 26-year-old man with common variable immunodeficiency: a case report" pot
... Universitario de Alicante, Alicante,
Spain.
2
Hematology Service, Hospital Marina Baixa, Villajoyosa, Spain.
Authors’ contributions
APS and MLT conceived the study and drafted the manuscript, SPD and
AGP ... mg/day for five days) and a tapering course of
oral prednisone. Two weeks later, his visual acuity was
one in the right eye and 0.6 in the left eye. Our patient
remained asymp...